Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Xanthomonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Xylella fastidiosa 9a5c 4 3
Xanthomonas axonopodis pv. citri str. 306 5 4
Xanthomonas campestris pv. campestris str. ATCC 33913 5 4
Stenotrophomonas maltophilia K279a 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
omr1
*
Xylella fastidiosa 9a5c

Site:
position = -122
score = 4.68153
sequence = TGAATGATATAATATTACCTTAC

Gene: XF0384: predicted zinc-related TonB-dependent outer membrane transporter
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -138
score = 5.4432
sequence = GACGTGGAATAATATAACATCTT

Gene: XAC2829: predicted zinc-related TonB-dependent outer membrane transporter
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -138
score = 5.4432
sequence = GACGTGGAATAATATAACATCTT

Gene: XCC2658: predicted zinc-related TonB-dependent outer membrane transporter
*
Stenotrophomonas maltophilia K279a

Site:
position = -111
score = 5.59306
sequence = GTTATGGAATAATATAACATCCC

Gene: Smlt1446: predicted zinc-related TonB-dependent outer membrane transporter
predicted zinc-related TonB-dependent outer membrane transporter
 
CRON 2.
omr2
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -63
score = 5.23497
sequence = AGTATGTTATAACATGTCATTTC

Gene: XAC0690: predicted zinc-related TonB-dependent outer membrane transporter
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -56
score = 4.67018
sequence = ATTACGTTATAATATATCGATAC

Gene: XCC2046: predicted zinc-related TonB-dependent outer membrane transporter
*
Stenotrophomonas maltophilia K279a

Site:
position = -42
score = 6.13482
sequence = GAAATGTTATATGATTACATTTC

Gene: Smlt0157: predicted zinc-related TonB-dependent outer membrane transporter
predicted zinc-related TonB-dependent outer membrane transporter
 
CRON 3.
folE2
*
Xylella fastidiosa 9a5c

Site:
position = -196
score = 5.67705
sequence = GTTATGTTATTTTATAACATATT

Gene: XF2096: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Xanthomonas axonopodis pv. citri str. 306

Gene: XAC1781: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Xanthomonas campestris pv. campestris str. ATCC 33913

Gene: XCC1764: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Stenotrophomonas maltophilia K279a
GTP cyclohydrolase I (EC 3.5.4.16) type 2
can
 
Xylella fastidiosa 9a5c

Gene: XF2095: Carbonic anhydrase, gamma class (EC 4.2.1.1)
 
Xanthomonas axonopodis pv. citri str. 306
 
Xanthomonas campestris pv. campestris str. ATCC 33913
 
Stenotrophomonas maltophilia K279a
Carbonic anhydrase, gamma class (EC 4.2.1.1)
amiC
 
Xylella fastidiosa 9a5c
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -153
score = 5.7151
sequence = TTGATGTTACTTTATAACACTTG

Gene: XAC1780: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -152
score = 5.54637
sequence = CTAGTGTTACTTTATAACACTTG

Gene: XCC1763: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
 
Stenotrophomonas maltophilia K279a
N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
 
CRON 4.
yciC
*
Xylella fastidiosa 9a5c

Site:
position = -108
score = 4.21914
sequence = AGAATGATATAAAGTATCAAATT

Gene: XF1830: Putative zinc chaperone, COG0523 family
*
Xanthomonas axonopodis pv. citri str. 306

Site:
position = -43
score = 5.69164
sequence = TAAGTGTTATATAGTAACACTCC

Gene: XAC0276: Putative zinc chaperone, COG0523 family
*
Xanthomonas campestris pv. campestris str. ATCC 33913

Site:
position = -41
score = 5.56421
sequence = GAGTTGTTATACAGTAACATTTC

Gene: XCC0257: Putative zinc chaperone, COG0523 family
*
Stenotrophomonas maltophilia K279a

Site:
position = -48
score = 5.51917
sequence = TAAGTGTTATACAGTAACATTCC

Gene: Smlt0520: Putative zinc chaperone, COG0523 family
Putative zinc chaperone, COG0523 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD