Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 17 11
Acinetobacter baumannii AB0057 9 7
Psychrobacter arcticum 273-4 5 3
Psychrobacter sp. PRwf-1 9 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuA2
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -100
score = 6.37037
sequence = TTATTGTTATAATATAACATACT

Gene: PsycPRwf_1910: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 2.
yciC
*
Acinetobacter sp. ADP1

Site:
position = -128
score = 6.44328
sequence = TATATGTTACATTATAACATAAC

Gene: ACIAD1741: Putative metal chaperone, GTPase of COG0523 family
*
Acinetobacter baumannii AB0057

Site:
position = -77
score = 6.39958
sequence = GTTATGTTATAACATAACATTAT

Gene: AB57_3864: Putative metal chaperone, GTPase of COG0523 family
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Putative metal chaperone, GTPase of COG0523 family
folE2
 
Acinetobacter sp. ADP1

Gene: ACIAD1740: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
CRON 3.
znuA
*
Acinetobacter sp. ADP1

Site:
position = -36
score = 5.65671
sequence = AATTTGTTATAATATAACACAAG

Gene: ACIAD0177: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Acinetobacter baumannii AB0057

Site:
position = -51
score = 5.81642
sequence = ACTTTGTTATATTATAACATGCT

Gene: AB57_0185: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Psychrobacter arcticum 273-4

Site:
position = -83
score = 6.80324
sequence = ATTATGTTATAGTATAACATAAT

Gene: Psyc_2032: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Psychrobacter sp. PRwf-1

Site:
position = -142
score = 6.09874
sequence = TATTAGTTATAGTATAACATATC

Gene: PsycPRwf_0185: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 4.
zur
*
Acinetobacter sp. ADP1

Site:
position = -97
score = 6.10945
sequence = CTTGTGTTATATTATAACAAATT

Gene: ACIAD0176: Zinc uptake regulation protein ZUR
*
Acinetobacter baumannii AB0057

Site:
position = -111
score = 5.93125
sequence = AGCATGTTATAATATAACAAAGT

Gene: AB57_0184: Zinc uptake regulation protein ZUR
*
Psychrobacter arcticum 273-4

Site:
position = -187
score = 6.76161
sequence = ATTATGTTATACTATAACATAAT

Gene: Psyc_2033: Zinc uptake regulation protein ZUR
*
Psychrobacter sp. PRwf-1

Site:
position = -408
score = 5.80252
sequence = GATATGTTATACTATAACTAATA

Gene: PsycPRwf_0184: Zinc uptake regulation protein ZUR
Zinc uptake regulation protein ZUR
znuC
 
Acinetobacter sp. ADP1

Gene: ACIAD0175: Zinc ABC transporter, ATP-binding protein ZnuC
 
Acinetobacter baumannii AB0057

Gene: AB57_0183: Zinc ABC transporter, ATP-binding protein ZnuC
 
Psychrobacter arcticum 273-4

Gene: Psyc_2034: Zinc ABC transporter, ATP-binding protein ZnuC
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0183: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Acinetobacter sp. ADP1

Gene: ACIAD0174: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Acinetobacter baumannii AB0057

Gene: AB57_0182: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Psychrobacter arcticum 273-4

Gene: Psyc_2035: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0182: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 5.
omr3
*
Acinetobacter sp. ADP1

Site:
position = -54
score = 6.1914
sequence = GTAATGTTATAGTATTACAATTA

Gene: ACIAD1003: Ferrichrome-iron receptor
*
Acinetobacter baumannii AB0057

Site:
position = -54
score = 5.90106
sequence = GTAACGTTATACTATTACATTTA

Gene: AB57_0135: Ferrichrome-iron receptor
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Ferrichrome-iron receptor
 
CRON 6.
rpmE2
*
Acinetobacter sp. ADP1

Site:
position = -54
score = 6.17714
sequence = AAAATGAAATAATATAACATTAC

Gene: ACIAD0425: LSU ribosomal protein L31p
*
Acinetobacter baumannii AB0057

Site:
position = -54
score = 6.00088
sequence = TGAGTGTTATGTTATAACATTTC

Gene: AB57_0468: LSU ribosomal protein L31p
 
Psychrobacter arcticum 273-4

Gene: Psyc_1916: LSU ribosomal protein L31p
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0507: LSU ribosomal protein L31p
LSU ribosomal protein L31p
 
CRON 7.
rpmJ
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -121
score = 6.59972
sequence = TTAATGTTATGTTATAACATAAT

Gene: PsycPRwf_1926: LSU ribosomal protein L36p
LSU ribosomal protein L36p
 
CRON 8.
omr1
*2
Acinetobacter sp. ADP1

Site:
position = -25
score = 5.45793
sequence = AAATAGATATATTATAACGTAAC

Gene: ACIAD0612: Zinc-regulated outer membrane receptor

Site:
position = -64
score = 6.191
sequence = GCAATGTTATAATATTACAAAAA

Gene: ACIAD0611: Zinc-regulated outer membrane receptor
*2
Acinetobacter baumannii AB0057

Site:
position = -41
score = 6.04069
sequence = TAAGTGTTATATTATAATATAAC

Gene: AB57_3926: Zinc-regulated outer membrane receptor

Site:
position = -51
score = 6.71441
sequence = GAAATGTTATAATATAACAAAAC

Gene: AB57_3396: Zinc-regulated outer membrane receptor
 
Psychrobacter arcticum 273-4
*2
Psychrobacter sp. PRwf-1

Site:
position = -92
score = 6.76161
sequence = GTTATGTTATACTATAACATAAC

Gene: PsycPRwf_2339: Zinc-regulated outer membrane receptor

Site:
position = -86
score = 6.80324
sequence = GTTATGTTATAGTATAACATAAC

Gene: PsycPRwf_2340: Zinc-regulated outer membrane receptor
Zinc-regulated outer membrane receptor
 
CRON 9.
Psyc_1790
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
*
Psychrobacter arcticum 273-4

Site:
position = -165
score = 5.67059
sequence = AAATTGATATATTATAAAATAAT

Gene: Psyc_1790: Zn-dependent hydrolases, including glyoxylases
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0570: Zn-dependent hydrolases, including glyoxylases
Zn-dependent hydrolases, including glyoxylases
 
CRON 10.
ACIAD1328
*
Acinetobacter sp. ADP1

Site:
position = -43
score = 5.03315
sequence = GGAATGTTATAGTATTTGAAATT

Gene: ACIAD1328: Zinc metalloprotease (EC 3.4.24.-)
 
Acinetobacter baumannii AB0057

Gene: AB57_2603: Zinc metalloprotease (EC 3.4.24.-)
 
Psychrobacter arcticum 273-4

Gene: Psyc_0209: Zinc metalloprotease (EC 3.4.24.-)
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0358: Zinc metalloprotease (EC 3.4.24.-)
Zinc metalloprotease (EC 3.4.24.-)
 
CRON 11.
tonB
*
Acinetobacter sp. ADP1

Site:
position = -253
score = 5.70807
sequence = AAAGTATTATGTTATAACATAAT

Gene: ACIAD0507: Ferric siderophore transport system, periplasmic binding protein TonB
 
Acinetobacter baumannii AB0057

Gene: AB57_0535: Ferric siderophore transport system, periplasmic binding protein TonB
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Ferric siderophore transport system, periplasmic binding protein TonB
exbB
 
Acinetobacter sp. ADP1

Gene: ACIAD0508: MotA/TolQ/ExbB proton channel family protein
 
Acinetobacter baumannii AB0057

Gene: AB57_0536: MotA/TolQ/ExbB proton channel family protein
 
Psychrobacter arcticum 273-4

Gene: Psyc_1663: MotA/TolQ/ExbB proton channel family protein
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1513: MotA/TolQ/ExbB proton channel family protein
MotA/TolQ/ExbB proton channel family protein
exbD
 
Acinetobacter sp. ADP1

Gene: ACIAD0509: Biopolymer transport protein ExbD/TolR
 
Acinetobacter baumannii AB0057

Gene: AB57_0537: Biopolymer transport protein ExbD/TolR
 
Psychrobacter arcticum 273-4

Gene: Psyc_1662: Biopolymer transport protein ExbD/TolR
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1512: Biopolymer transport protein ExbD/TolR
Biopolymer transport protein ExbD/TolR
 
CRON 12.
can
*
Acinetobacter sp. ADP1

Site:
position = -101
score = 6.32285
sequence = TATTTGTTATGTTATAACATAAC

Gene: ACIAD1420: Carbonic anhydrase, gamma class (EC 4.2.1.1)
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Carbonic anhydrase, gamma class (EC 4.2.1.1)
pyrC2
 
Acinetobacter sp. ADP1

Gene: ACIAD1419: Dihydroorotase (EC 3.5.2.3)
 
Acinetobacter baumannii AB0057

Gene: AB57_1001: Dihydroorotase (EC 3.5.2.3)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Dihydroorotase (EC 3.5.2.3)
 
CRON 13.
omr2
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -97
score = 5.01819
sequence = AAAACGTTATGTTATACTATAAC

Gene: PsycPRwf_2339: Zinc-regulated outer membrane receptor
Zinc-regulated outer membrane receptor
 
CRON 14.
ACIAD1742
*
Acinetobacter sp. ADP1

Site:
position = -44
score = 5.12065
sequence = CCAATGTTATAATGTAACAGTTA

Gene: ACIAD1742: hypothetical protein; putative signal peptide
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
hypothetical protein; putative signal peptide
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD