Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 62 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 17 10
Pseudomonas entomophila L48 16 9
Pseudomonas putida KT2440 15 8
Pseudomonas syringae pv. tomato str. DC3000 11 6
Pseudomonas fluorescens Pf-5 21 10
Pseudomonas mendocina ymp 12 5
Pseudomonas stutzeri A1501 10 6
Azotobacter vinelandii AvOP 12 7
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
folE2
*
Pseudomonas aeruginosa PAO1

Site:
position = -63
score = 5.52655
sequence = AATACGTTATATTATAACATTCA

Gene: PA5539: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Pseudomonas entomophila L48

Gene: PSEEN5515: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Pseudomonas putida KT2440

Gene: PP3324: GTP cyclohydrolase I (EC 3.5.4.16) type 2
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -108
score = 5.3525
sequence = ATGATGTTATAGTGTAACGAATT

Gene: PSPTO2578: GTP cyclohydrolase I (EC 3.5.4.16) type 2
*
Pseudomonas fluorescens Pf-5

Site:
position = -50
score = 5.08307
sequence = GCATTGTTATAATATAACATGTG

Gene: PFL_6177: GTP cyclohydrolase I (EC 3.5.4.16) type 2
*
Pseudomonas mendocina ymp

Site:
position = -50
score = 5.94793
sequence = CAATTGTTATAACATAACATTTA

Gene: Pmen_4538: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Pseudomonas stutzeri A1501
*
Azotobacter vinelandii AvOP

Site:
position = -118
score = 5.27403
sequence = CTTTTGTTATGTTATAACACATA

Gene: Avin_29210: GTP cyclohydrolase I (EC 3.5.4.16) type 2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
znuC2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2633: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6178: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2634: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6179: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501

Gene: PST_3085: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Azotobacter vinelandii AvOP
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2635: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6180: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Zinc ABC transporter, periplasmic-binding protein ZnuA
hisI2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
*
Pseudomonas putida KT2440

Site:
position = -84
score = 5.11455
sequence = TAAGTGTTATAACATAACATCTA

Gene: PP3320: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6181: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Pseudomonas mendocina ymp

Gene: Pmen_4539: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
can
 
Pseudomonas aeruginosa PAO1

Gene: PA5540: Carbonic anhydrase (EC 4.2.1.1)
*
Pseudomonas entomophila L48

Site:
position = -52
score = 5.44817
sequence = TAAATGTTATAATATAACAATTG

Gene: PSEEN3120: Carbonic anhydrase (EC 4.2.1.1)
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2579: Carbonic anhydrase (EC 4.2.1.1)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6182: Carbonic anhydrase (EC 4.2.1.1)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP

Gene: Avin_29200: Carbonic anhydrase (EC 4.2.1.1)
Carbonic anhydrase (EC 4.2.1.1)
pyrC2
 
Pseudomonas aeruginosa PAO1

Gene: PA5541: Dihydroorotase (EC 3.5.2.3)
 
Pseudomonas entomophila L48

Gene: PSEEN3119: Dihydroorotase (EC 3.5.2.3)
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6183: Dihydroorotase (EC 3.5.2.3)
 
Pseudomonas mendocina ymp

Gene: Pmen_4541: Dihydroorotase (EC 3.5.2.3)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Dihydroorotase (EC 3.5.2.3)
PP3321
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
*
Pseudomonas putida KT2440

Site:
position = -3
score = 5.2972
sequence = TAGATGTTATGTTATAACACTTA

Gene: PP3321: hypothetical protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2132: hypothetical protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_3821: hypothetical protein
 
Pseudomonas mendocina ymp

Gene: Pmen_4181: hypothetical protein
 
Pseudomonas stutzeri A1501

Gene: PST_1096: hypothetical protein
 
Azotobacter vinelandii AvOP
hypothetical protein
hemB2
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440

Gene: PP3322: Porphobilinogen synthase (EC 4.2.1.24)
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Porphobilinogen synthase (EC 4.2.1.24)
yciC3
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440

Gene: PP3323: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Putative metal chaperone, GTPase of COG0523 family
DUF37
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp

Gene: Pmen_4540: Protein of unknown function DUF37
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Protein of unknown function DUF37
dksA2
*
Pseudomonas aeruginosa PAO1

Site:
position = -43
score = 5.54042
sequence = TAATTGTTATAGTATAACGTTTT

Gene: PA5536: C4-type zinc finger protein, DksA/TraR family
 
Pseudomonas entomophila L48

Gene: PSEEN3118: C4-type zinc finger protein, DksA/TraR family
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -48
score = 5.93557
sequence = GTGTTGTTATAATATAACATAAA

Gene: PFL_6174: C4-type zinc finger protein, DksA/TraR family
*
Pseudomonas mendocina ymp

Site:
position = -44
score = 5.06285
sequence = TAAATGTTATGTTATAACAATTG

Gene: Pmen_4537: C4-type zinc finger protein, DksA/TraR family
*
Pseudomonas stutzeri A1501

Site:
position = -90
score = 4.69604
sequence = TAAACGTTATGTTATAACTAATC

Gene: PST_3603: C4-type zinc finger protein, DksA/TraR family
*
Azotobacter vinelandii AvOP

Site:
position = -119
score = 5.22936
sequence = AAAATGTTATGTTATAACTATAA

Gene: Avin_22970: C4-type zinc finger protein, DksA/TraR family
C4-type zinc finger protein, DksA/TraR family
yciC
 
Pseudomonas aeruginosa PAO1

Gene: PA5535: Putative metal chaperone, GTPase of COG0523 family
*
Pseudomonas entomophila L48

Site:
position = -70
score = 4.57183
sequence = AAATTGTATTGTTATAATATAAC

Site:
position = -65
score = 5.85945
sequence = GTATTGTTATAATATAACATTGC

Gene: PSEEN5513: Putative metal chaperone, GTPase of COG0523 family
*
Pseudomonas putida KT2440

Site:
position = -65
score = 5.09009
sequence = GTATTGTTACCTTATAACATTAT

Gene: PP5361: Putative metal chaperone, GTPase of COG0523 family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -108
score = 5.39966
sequence = GTGTTGTTATACTATAACATCAT

Gene: PSPTO5526: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6173: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas mendocina ymp

Gene: Pmen_4536: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas stutzeri A1501

Gene: PST_3604: Putative metal chaperone, GTPase of COG0523 family
 
Azotobacter vinelandii AvOP

Gene: Avin_22980: Putative metal chaperone, GTPase of COG0523 family
Putative metal chaperone, GTPase of COG0523 family
PF08856
 
Pseudomonas aeruginosa PAO1

Gene: PA5534: hypothetical protein
 
Pseudomonas entomophila L48

Gene: PSEEN5512: hypothetical protein
 
Pseudomonas putida KT2440

Gene: PP5360: hypothetical protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5525: hypothetical protein
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6172: hypothetical protein
 
Pseudomonas mendocina ymp

Gene: Pmen_4535: hypothetical protein
 
Pseudomonas stutzeri A1501

Gene: PST_3605: hypothetical protein
 
Azotobacter vinelandii AvOP

Gene: Avin_22990: hypothetical protein
hypothetical protein
yciC2
 
Pseudomonas aeruginosa PAO1

Gene: PA5532: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas entomophila L48

Gene: PSEEN5511: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas putida KT2440

Gene: PP5359: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5523: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas fluorescens Pf-5

Gene: PFL_6171: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas mendocina ymp

Gene: Pmen_4533: Putative metal chaperone, GTPase of COG0523 family
 
Pseudomonas stutzeri A1501

Gene: PST_4179: Putative metal chaperone, GTPase of COG0523 family
 
Azotobacter vinelandii AvOP

Gene: Avin_01740: Putative metal chaperone, GTPase of COG0523 family
Putative metal chaperone, GTPase of COG0523 family
PA4838
*
Pseudomonas aeruginosa PAO1

Site:
position = -122
score = 5.09085
sequence = GAAATGATATACTATAACGCTAC

Gene: PA4838: membrane protein-like protein
*
Pseudomonas entomophila L48

Site:
position = -62
score = 5.30657
sequence = AAAAAGATATAAGATAACATTTC

Gene: PSEEN2389: membrane protein-like protein
 
Pseudomonas putida KT2440

Gene: PP2419: membrane protein-like protein
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO2580: membrane protein-like protein
 
Pseudomonas fluorescens Pf-5
 
Pseudomonas mendocina ymp
*
Pseudomonas stutzeri A1501

Site:
position = -113
score = 5.17287
sequence = CTTTTGTTATAACGTATCGCACC

Gene: PST_2941: membrane protein-like protein
 
Azotobacter vinelandii AvOP
membrane protein-like protein
PA5537
*
Pseudomonas aeruginosa PAO1

Site:
position = -92
score = 5.16189
sequence = AAAACGTTATACTATAACAATTA

Gene: PA5537: hypothetical protein
*
Pseudomonas entomophila L48

Site:
position = -67
score = 5.4493
sequence = GCAATGTTATATTATAACAATAC

Gene: PSEEN5514: hypothetical protein
*
Pseudomonas putida KT2440

Site:
position = -72
score = 5.81849
sequence = ATAATGTTATAAGGTAACAATAC

Gene: PP5362: hypothetical protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -56
score = 5.53758
sequence = ATGATGTTATAGTATAACAACAC

Gene: PSPTO5527: hypothetical protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -96
score = 5.37684
sequence = TTTATGTTATATTATAACAACAC

Gene: PFL_6175: hypothetical protein
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
*
Azotobacter vinelandii AvOP

Site:
position = -44
score = 4.78292
sequence = AAAATGTTATATAGTTTCATCCT

Gene: Avin_29230: hypothetical protein
hypothetical protein
 
CRON 2.
znuA
*
Pseudomonas aeruginosa PAO1

Site:
position = -48
score = 4.63904
sequence = GAGACGTTATTATATTACCCGCT

Gene: PA5498: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas entomophila L48

Site:
position = -45
score = 4.71232
sequence = GAGACGTTATTATGTTACCTGTT

Gene: PSEEN0073: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas putida KT2440

Site:
position = -45
score = 4.71232
sequence = GAGACGTTATTATGTTACCTGTT

Gene: PP0120: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -46
score = 4.71232
sequence = GAGACGTTATTATGTTACCTGTT

Gene: PSPTO5268: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas fluorescens Pf-5

Site:
position = -36
score = 4.59683
sequence = GAGACGTTATTATGTTACCCGTT

Gene: PFL_0079: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas mendocina ymp

Site:
position = -45
score = 4.68428
sequence = GAGACGTTATTATATTACCCGTT

Gene: Pmen_4495: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Pseudomonas stutzeri A1501

Site:
position = -37
score = 4.83404
sequence = GAGACGTTATTATGTACCAATTC

Gene: PST_0044: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Azotobacter vinelandii AvOP

Site:
position = -44
score = 4.55367
sequence = GAGACGTTATTCTATTACACTTT

Gene: Avin_00830: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 3.
zur
*
Pseudomonas aeruginosa PAO1

Site:
position = -44
score = 3.75427
sequence = AGCGGGTAATATAATAACGTCTC

Gene: PA5499: Zinc uptake regulation protein ZUR
*
Pseudomonas entomophila L48

Site:
position = -44
score = 4.18045
sequence = AACAGGTAACATAATAACGTCTC

Gene: PSEEN0072: Zinc uptake regulation protein ZUR
*
Pseudomonas putida KT2440

Site:
position = -122
score = 4.18045
sequence = AACAGGTAACATAATAACGTCTC

Gene: PP0119: Zinc uptake regulation protein ZUR
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -44
score = 4.18045
sequence = AACAGGTAACATAATAACGTCTC

Gene: PSPTO5267: Zinc uptake regulation protein ZUR
*
Pseudomonas fluorescens Pf-5

Site:
position = -44
score = 3.71181
sequence = AACGGGTAACATAATAACGTCTC

Gene: PFL_0078: Zinc uptake regulation protein ZUR
*
Pseudomonas mendocina ymp

Site:
position = -44
score = 4.0303
sequence = AACGGGTAATATAATAACGTCTC

Gene: Pmen_4496: Zinc uptake regulation protein ZUR
*
Pseudomonas stutzeri A1501

Site:
position = -44
score = 4.4828
sequence = GAATTGGTACATAATAACGTCTC

Gene: PST_0043: Zinc uptake regulation protein ZUR
*
Azotobacter vinelandii AvOP

Site:
position = -41
score = 4.53822
sequence = AAAGTGTAATAGAATAACGTCTC

Gene: Avin_00840: Zinc uptake regulation protein ZUR
Zinc uptake regulation protein ZUR
znuC
 
Pseudomonas aeruginosa PAO1

Gene: PA5500: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas entomophila L48

Gene: PSEEN0071: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas putida KT2440

Gene: PP0118: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5266: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0077: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas mendocina ymp

Gene: Pmen_4497: Zinc ABC transporter, ATP-binding protein ZnuC
 
Pseudomonas stutzeri A1501

Gene: PST_0042: Zinc ABC transporter, ATP-binding protein ZnuC
 
Azotobacter vinelandii AvOP

Gene: Avin_00850: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Pseudomonas aeruginosa PAO1

Gene: PA5501: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas entomophila L48

Gene: PSEEN0070: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas putida KT2440

Gene: PP0117: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5265: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas fluorescens Pf-5

Gene: PFL_0076: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas mendocina ymp

Gene: Pmen_4498: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Pseudomonas stutzeri A1501

Gene: PST_0041: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Azotobacter vinelandii AvOP

Gene: Avin_00860: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 4.
omr
*
Pseudomonas aeruginosa PAO1

Site:
position = -121
score = 4.99169
sequence = AAAAAGAAATAATATAACATCCC

Gene: PA0781: Zinc-regulated outer membrane receptor
*
Pseudomonas entomophila L48

Site:
position = -51
score = 5.11772
sequence = GATACGTTATAAAGTAACAACAA

Gene: PSEEN1173: Zinc-regulated outer membrane receptor
*
Pseudomonas putida KT2440

Site:
position = -53
score = 5.30419
sequence = GTTATGTTATGTTGTAACACTAA

Gene: PP1446: Zinc-regulated outer membrane receptor
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -113
score = 5.19502
sequence = GAGATGTTATATTGTATCAATCA

Gene: PFL_4912: Zinc-regulated outer membrane receptor
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Zinc-regulated outer membrane receptor
 
CRON 5.
amiA
*
Pseudomonas aeruginosa PAO1

Site:
position = -59
score = 5.60218
sequence = TGAATGTTATAATATAACGTATT

Gene: PA5538: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO5528: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
*
Pseudomonas fluorescens Pf-5

Site:
position = -102
score = 5.55878
sequence = CACATGTTATATTATAACAATGC

Gene: PFL_6176: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
*
Azotobacter vinelandii AvOP

Site:
position = -68
score = 4.97953
sequence = TATGTGTTATAACATAACAAAAG

Gene: Avin_29220: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
 
CRON 6.
zbp
*
Pseudomonas aeruginosa PAO1

Site:
position = -51
score = 5.71676
sequence = AATTCGTTATAACGTAACAAACT

Gene: PA4063: Predicted zinc-binding protein
*
Pseudomonas entomophila L48

Site:
position = -50
score = 5.61594
sequence = AAGTTGTTATAACATTACCAAAT

Gene: PSEEN0582: Predicted zinc-binding protein
*
Pseudomonas putida KT2440

Site:
position = -48
score = 5.74973
sequence = ATCTTGTTATAACATAACCCTAT

Gene: PP0508: Predicted zinc-binding protein
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -54
score = 5.73284
sequence = CACTTGTTATAAGATCACATAAC

Gene: PSPTO0683: Predicted zinc-binding protein
*
Pseudomonas fluorescens Pf-5

Site:
position = -54
score = 5.53836
sequence = CGATTGTTATAAGATCACATAAC

Gene: PFL_5528: Predicted zinc-binding protein
*
Pseudomonas mendocina ymp

Site:
position = -48
score = 5.91332
sequence = AAGTTGTTATAACGTAACGATTC

Gene: Pmen_3863: Predicted zinc-binding protein
*
Pseudomonas stutzeri A1501

Site:
position = -41
score = 5.98356
sequence = AAGTTGTTATAACGTAACGTACC

Gene: PST_0827: Predicted zinc-binding protein
*
Azotobacter vinelandii AvOP

Site:
position = -40
score = 5.83225
sequence = AACTCGTTATAACGTAACAAAAC

Gene: Avin_06650: Predicted zinc-binding protein
Predicted zinc-binding protein
 
CRON 7.
rpmE2
*
Pseudomonas aeruginosa PAO1

Site:
position = -38
score = 5.52552
sequence = AATATGTAACTATATAACATTAT

Gene: PA3601: LSU ribosomal protein L31p
*
Pseudomonas entomophila L48

Site:
position = -43
score = 5.19852
sequence = AGTATGTTATAAAGTATCACTTT

Gene: PSEEN1181: LSU ribosomal protein L31p
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO4183: LSU ribosomal protein L31p
*
Pseudomonas fluorescens Pf-5

Site:
position = -51
score = 5.28103
sequence = GATATGTTATTGTATAACGCATC

Gene: PFL_4896: LSU ribosomal protein L31p
 
Pseudomonas mendocina ymp
*
Pseudomonas stutzeri A1501

Site:
position = -51
score = 5.56736
sequence = CTATTGTTATGTTATAACATCAT

Gene: PST_1798: LSU ribosomal protein L31p
 
Azotobacter vinelandii AvOP
LSU ribosomal protein L31p
rpmJ
 
Pseudomonas aeruginosa PAO1

Gene: PA3600: LSU ribosomal protein L36p
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -47
score = 4.7526
sequence = AATATGATATGTTATTACATTAG

Gene: PFL_3806: LSU ribosomal protein L36p
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
LSU ribosomal protein L36p
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD