Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 16 7
Marinobacter aqueolei 2 2
Marinobacter sp. ELB17 5 4
Oceanobacter sp. RED65 1 1
Oceanospirillum sp. MED92 9 6
Marinomonas sp. MWYL1 7 4
Saccharophagus degradans 2-40 6 3
Teredinibacter turnerae T7901 6 3
Cellvibrio japonicus Ueda107 5 3
Chromohalobacter salexigens DSM 3043 6 4
Reinekea sp. MED297 7 3
Alcanivorax borkumensis SK2 12 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
zbp
*
Hahella chejuensis KCTC 2396

Site:
position = -70
score = 5.71739
sequence = GTTTCGTTATGTTATAACATAAA

Gene: HCH_00656: Predicted zinc-binding protein
*
Marinobacter aqueolei

Site:
position = -39
score = 5.60099
sequence = AAAATGTTATAACATATCAAATA

Gene: Maqu_3429: Predicted zinc-binding protein
*
Marinobacter sp. ELB17

Site:
position = -34
score = 5.86207
sequence = AAGATGTTATAACATAACTTTAC

Gene: MELB17_02870: Predicted zinc-binding protein
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -28
score = 5.68266
sequence = TTGTTGTTATATTATAACTTTTA

Gene: MED92_15318: Predicted zinc-binding protein
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1976: Predicted zinc-binding protein
 
Teredinibacter turnerae T7901

Gene: TERTU_2265: Predicted zinc-binding protein
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1675: Predicted zinc-binding protein
Predicted zinc-binding protein
 
CRON 2.
zinT
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
*
Chromohalobacter salexigens DSM 3043

Site:
position = -70
score = 5.33914
sequence = AGAAAGATATGTTATAACGTATT

Gene: Csal_0187: Candidate zinc-binding lipoprotein ZinT
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Candidate zinc-binding lipoprotein ZinT
 
CRON 3.
HCH_02943
*
Hahella chejuensis KCTC 2396

Site:
position = -66
score = 4.93623
sequence = AAAAAGATATGATGCAACATATC

Gene: HCH_02943: hypothetical protein
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
hypothetical protein
omr
 
Hahella chejuensis KCTC 2396

Gene: HCH_02944: Zinc-regulated TonB-dependent outer membrane receptor
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Zinc-regulated TonB-dependent outer membrane receptor
znuA2
 
Hahella chejuensis KCTC 2396

Gene: HCH_02945: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuB2
 
Hahella chejuensis KCTC 2396

Gene: HCH_02946: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 4.
znuC
 2
Hahella chejuensis KCTC 2396

Gene: HCH_00536: Zinc ABC transporter, ATP-binding protein ZnuC

Gene: HCH_02940: Zinc ABC transporter, ATP-binding protein ZnuC
 
Marinobacter aqueolei

Gene: Maqu_3776: Zinc ABC transporter, ATP-binding protein ZnuC
*2
Marinobacter sp. ELB17

Site:
position = -102
score = 5.5346
sequence = TGAACGTTATGTTATAACATTGC

Gene: MELB17_12886: Zinc ABC transporter, ATP-binding protein ZnuC

Gene: MELB17_01715: Zinc ABC transporter, ATP-binding protein ZnuC
 
Oceanobacter sp. RED65

Gene: RED65_08379: Zinc ABC transporter, ATP-binding protein ZnuC
 
Oceanospirillum sp. MED92

Gene: MED92_05838: Zinc ABC transporter, ATP-binding protein ZnuC
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0293: Zinc ABC transporter, ATP-binding protein ZnuC
 
Saccharophagus degradans 2-40

Gene: Sde_0058: Zinc ABC transporter, ATP-binding protein ZnuC
 
Teredinibacter turnerae T7901

Gene: TERTU_0052: Zinc ABC transporter, ATP-binding protein ZnuC
 
Cellvibrio japonicus Ueda107

Gene: CJA_3483: Zinc ABC transporter, ATP-binding protein ZnuC
*
Chromohalobacter salexigens DSM 3043

Site:
position = -56
score = 5.86682
sequence = AAAGAGTTATGTTATAACATATA

Gene: Csal_0189: Zinc ABC transporter, ATP-binding protein ZnuC
*
Reinekea sp. MED297

Site:
position = -124
score = 5.38642
sequence = TAAATGATATGATGTATCATAAC

Site:
position = -119
score = 5.15138
sequence = GATATGATGTATCATAACAAATA

Gene: MED297_11285: Zinc ABC transporter, ATP-binding protein ZnuC
 
Alcanivorax borkumensis SK2

Gene: ABO_0156: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 2
Hahella chejuensis KCTC 2396

Gene: HCH_00535: Zinc ABC transporter, inner membrane permease protein ZnuB

Gene: HCH_02939: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Marinobacter aqueolei

Gene: Maqu_3777: Zinc ABC transporter, inner membrane permease protein ZnuB
 2
Marinobacter sp. ELB17

Gene: MELB17_12881: Zinc ABC transporter, inner membrane permease protein ZnuB

Gene: MELB17_01710: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Oceanobacter sp. RED65

Gene: RED65_08384: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Oceanospirillum sp. MED92

Gene: MED92_05833: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0294: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Saccharophagus degradans 2-40

Gene: Sde_0057: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Teredinibacter turnerae T7901

Gene: TERTU_0051: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Cellvibrio japonicus Ueda107

Gene: CJA_3484: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0190: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Reinekea sp. MED297

Gene: MED297_11290: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Alcanivorax borkumensis SK2

Gene: ABO_0157: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
yciC
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_11295: Putative metal chaperone, GTPase of COG0523 family
 
Alcanivorax borkumensis SK2
Putative metal chaperone, GTPase of COG0523 family
PF08856
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_11300: hypothetical protein
 
Alcanivorax borkumensis SK2
hypothetical protein
zur
*
Hahella chejuensis KCTC 2396

Site:
position = -80
score = 5.34799
sequence = CAATTGTTATAACATTACACTTC

Gene: HCH_00537: Zinc uptake regulation protein ZUR
 
Marinobacter aqueolei

Gene: Maqu_3775: Zinc uptake regulation protein ZUR
 
Marinobacter sp. ELB17

Gene: MELB17_01720: Zinc uptake regulation protein ZUR
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -43
score = 5.60068
sequence = TTAAAGTTACAATATAACACAAA

Gene: MED92_05843: Zinc uptake regulation protein ZUR
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0292: Zinc uptake regulation protein ZUR
*
Saccharophagus degradans 2-40

Site:
position = -51
score = 6.05745
sequence = AAAGTGTTATATGATAACATAAC

Gene: Sde_0059: Zinc uptake regulation protein ZUR
*
Teredinibacter turnerae T7901

Site:
position = -51
score = 5.95491
sequence = TAAACGTTATATGATAACATAAC

Gene: TERTU_0053: Zinc uptake regulation protein ZUR
*
Cellvibrio japonicus Ueda107

Site:
position = -53
score = 5.27147
sequence = GAAAGGTTATAGAGTAACATAAC

Gene: CJA_3482: Zinc uptake regulation protein ZUR
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1882: Zinc uptake regulation protein ZUR
 
Reinekea sp. MED297

Gene: MED297_11305: Zinc uptake regulation protein ZUR
 
Alcanivorax borkumensis SK2
Zinc uptake regulation protein ZUR
Mmwyl1_0291
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -51
score = 5.20792
sequence = TACTTGTTATATCATAACAAAAT

Gene: Mmwyl1_0291: putative membrane protein
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
putative membrane protein
zur2
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_11929: Zinc uptake regulation protein paralog
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_1974: Zinc uptake regulation protein paralog
 
Teredinibacter turnerae T7901

Gene: TERTU_3389: Zinc uptake regulation protein paralog
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -77
score = 5.85057
sequence = TTAATGATATATCATATCATTTA

Gene: MED297_00400: Zinc uptake regulation protein paralog
 
Alcanivorax borkumensis SK2
Zinc uptake regulation protein paralog
 
CRON 5.
rpmE2
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -35
score = 5.90339
sequence = ATATTGTTATGGTATAACATTTA

Site:
position = -138
score = 5.26583
sequence = GCAATGTTATAATATAGCAATTA

Gene: MED92_02998: ribosomal protein, L31P family protein
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
ribosomal protein, L31P family protein
 
CRON 6.
znuA
*2
Hahella chejuensis KCTC 2396

Site:
position = -84
score = 6.32725
sequence = GATATGTTACATCATAACATTTT

Gene: HCH_02942: Zinc ABC transporter, periplasmic-binding protein ZnuA

Site:
position = -64
score = 6.26484
sequence = ATAATGTTATGTTATAACCTTTC

Gene: HCH_02413: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Marinobacter aqueolei

Site:
position = -48
score = 6.29865
sequence = ATATTGTTATATTATAACGTTTC

Gene: Maqu_1892: Zinc ABC transporter, periplasmic-binding protein ZnuA
*2
Marinobacter sp. ELB17

Site:
position = -60
score = 5.68166
sequence = GCAATGTTATAACATAACGTTCA

Gene: MELB17_12891: Zinc ABC transporter, periplasmic-binding protein ZnuA

Site:
position = -68
score = 5.8443
sequence = GTTATGTAATATTATAACATTCT

Gene: MELB17_08596: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Oceanobacter sp. RED65

Gene: RED65_08374: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Oceanospirillum sp. MED92

Site:
position = -38
score = 5.66961
sequence = TTTGTGTTATATTGTAACTTTAA

Gene: MED92_05848: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Marinomonas sp. MWYL1

Site:
position = -40
score = 5.9036
sequence = GTATTGTTACGTTATAACATTAA

Gene: Mmwyl1_1122: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Saccharophagus degradans 2-40

Site:
position = -80
score = 6.04233
sequence = GTTATGTTATCATATAACACTTT

Gene: Sde_0060: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Teredinibacter turnerae T7901

Site:
position = -67
score = 6.12611
sequence = GTTATGTTATCATATAACGTTTA

Gene: TERTU_0054: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Cellvibrio japonicus Ueda107

Site:
position = -3
score = 5.44882
sequence = GTTATGTTACTCTATAACCTTTC

Gene: CJA_3480: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Chromohalobacter salexigens DSM 3043

Site:
position = -63
score = 5.92134
sequence = TATATGTTATAACATAACTCTTT

Gene: Csal_0188: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Reinekea sp. MED297

Site:
position = -61
score = 5.61903
sequence = GTTATGATACATCATATCATTTA

Gene: MED297_11280: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Alcanivorax borkumensis SK2

Gene: ABO_0155: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 7.
dksA2
 
Hahella chejuensis KCTC 2396

Gene: HCH_01707: C4-type zinc finger protein, DksA/TraR family
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -34
score = 5.74466
sequence = GCAATGTTATAACATAACATGAA

Gene: ABO_1680: C4-type zinc finger protein, DksA/TraR family
C4-type zinc finger protein, DksA/TraR family
yciC
*
Hahella chejuensis KCTC 2396

Site:
position = -59
score = 6.23194
sequence = GTTTTGTTATGTTATAACATTTT

Gene: HCH_02800: Putative metal chaperone, GTPase of COG0523 family
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
*
Marinomonas sp. MWYL1

Site:
position = -39
score = 6.61486
sequence = GAAATGTTATATCATAACATTTT

Gene: Mmwyl1_1446: Putative metal chaperone, GTPase of COG0523 family
*
Saccharophagus degradans 2-40

Site:
position = -184
score = 5.59838
sequence = ATAATGATATCATATATCATATC

Gene: Sde_1980: Putative metal chaperone, GTPase of COG0523 family
*
Teredinibacter turnerae T7901

Site:
position = -119
score = 5.46445
sequence = ATAATGATATGGTATATCATAAC

Site:
position = -114
score = 6.02538
sequence = GATATGGTATATCATAACGTTAC

Gene: TERTU_2263: Putative metal chaperone, GTPase of COG0523 family
*
Cellvibrio japonicus Ueda107

Site:
position = -46
score = 6.14821
sequence = AATGTGTTATGTTATAACATATT

Gene: CJA_3465: Putative metal chaperone, GTPase of COG0523 family
*
Chromohalobacter salexigens DSM 3043

Site:
position = -90
score = 5.87968
sequence = AGAATGTTATGGTATAACATATC

Gene: Csal_0192: Putative metal chaperone, GTPase of COG0523 family
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1679: Putative metal chaperone, GTPase of COG0523 family
Putative metal chaperone, GTPase of COG0523 family
PF08856
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
*
Oceanobacter sp. RED65

Site:
position = -47
score = 4.98884
sequence = GATATAATATATCATATCTTTTA

Site:
position = -52
score = 5.38233
sequence = CAAAAGATATAATATATCATATC

Gene: RED65_11939: hypothetical protein
*
Oceanospirillum sp. MED92

Site:
position = -44
score = 5.68613
sequence = GTTATGTTATATTGTATCTTTTT

Site:
position = -49
score = 5.07664
sequence = TTAAAGTTATGTTATATTGTATC

Gene: MED92_08311: hypothetical protein
*
Marinomonas sp. MWYL1

Site:
position = -18
score = 5.81457
sequence = AAAATGTTATAACGTAACATGTT

Site:
position = -23
score = 4.6425
sequence = TTTGTAAAATGTTATAACGTAAC

Gene: Mmwyl1_0929: hypothetical protein
 
Saccharophagus degradans 2-40

Gene: Sde_1979: hypothetical protein
 
Teredinibacter turnerae T7901

Gene: TERTU_2264: hypothetical protein
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1678: hypothetical protein
hypothetical protein
zur2
*
Hahella chejuensis KCTC 2396

Site:
position = -211
score = 5.70579
sequence = AAAAAGATATGATATAACGTATC

Site:
position = -206
score = 5.17965
sequence = GATATGATATAACGTATCTTTAT

Gene: HCH_01703: Zinc uptake regulation protein ZUR
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1677: Zinc uptake regulation protein ZUR
Zinc uptake regulation protein ZUR
RED65_11934
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1676: hypothetical protein
hypothetical protein
zbp
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1675: Predicted zinc-binding protein
Predicted zinc-binding protein
ABO_1674
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1674: Methionine ABC transporter ATP-binding protein
Methionine ABC transporter ATP-binding protein
ABO_1673
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1673: ABC-type antimicrobial peptide transport system, permease component
ABC-type antimicrobial peptide transport system, permease component
ABO_1672
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1672: lipoprotein, putative
lipoprotein, putative
hisI2
 2
Hahella chejuensis KCTC 2396

Gene: HCH_01079: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)

Gene: HCH_10001: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Marinobacter aqueolei

Gene: Maqu_3418: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Marinobacter sp. ELB17

Gene: MELB17_02925: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Oceanobacter sp. RED65

Gene: RED65_08999: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Oceanospirillum sp. MED92

Gene: MED92_00075: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2431: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Saccharophagus degradans 2-40

Gene: Sde_3222: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Teredinibacter turnerae T7901

Gene: TERTU_3194: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0745: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1883: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Reinekea sp. MED297

Gene: MED297_00285: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
 
Alcanivorax borkumensis SK2

Gene: ABO_2134: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
pyrC2
 
Hahella chejuensis KCTC 2396

Gene: HCH_01704: Dihydroorotase (EC 3.5.2.3)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
*
Oceanospirillum sp. MED92

Site:
position = -152
score = 5.711
sequence = TAAATGTTATACCATAACAATAT

Site:
position = -49
score = 5.51568
sequence = TAATTGCTATATTATAACATTGC

Gene: MED92_02993: Dihydroorotase (EC 3.5.2.3)
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1683: Dihydroorotase (EC 3.5.2.3)
Dihydroorotase (EC 3.5.2.3)
folE2
 
Hahella chejuensis KCTC 2396

Gene: HCH_01706: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65

Gene: RED65_08989: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Oceanospirillum sp. MED92

Gene: MED92_05463: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 2
Chromohalobacter salexigens DSM 3043

Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2

Gene: Csal_0191: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_2144: GTP cyclohydrolase I (EC 3.5.4.16) type 2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
ABO_1681
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -51
score = 4.85293
sequence = GTTATGTTATAACATTGCATCAA

Site:
position = -56
score = 5.70028
sequence = TTCATGTTATGTTATAACATTGC

Gene: ABO_1681: hypothetical protein
hypothetical protein
can
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_02988: Carbonic anhydrase (EC 4.2.1.1)
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2

Gene: ABO_1682: Carbonic anhydrase (EC 4.2.1.1)
Carbonic anhydrase (EC 4.2.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD