Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 1 1
Psychromonas sp. CNPT3 3 2
Moritella sp. PE36 6 5
Aeromonas hydrophila subsp. hydrophila ATCC 7966 5 3
Aeromonas salmonicida subsp. salmonicida A449 4 3
Tolumonas auensis DSM 9187 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -239
score = 5.56156
sequence = AAAATGTATTGTTATAACATAAC

Site:
position = -199
score = 5.17565
sequence = CTATTGTTATGTTATAACATTCG

Gene: PE36_02894: Zinc ABC transporter, ATP-binding protein ZnuC
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -74
score = 6.6772
sequence = TGTGTGTGATAATATAACAAACC

Gene: AHA_3729: Zinc ABC transporter, ATP-binding protein ZnuC
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -74
score = 6.48279
sequence = AGTGTGTGATAATATAACAAACC

Gene: ASA_0557: Zinc ABC transporter, ATP-binding protein ZnuC
*
Tolumonas auensis DSM 9187

Site:
position = -185
score = 5.66629
sequence = CGGGTGTTATGTTATAACATCCG

Gene: Tola_2913: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02899: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3730: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0556: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Tolumonas auensis DSM 9187

Gene: Tola_2914: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36

Gene: PE36_02904: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -70
score = 6.32469
sequence = TGAGAGTTATAATATAACAATAA

Gene: AHA_3728: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = 26
score = 6.17317
sequence = TGAGAGTTATAATATAACAGCAG

Gene: ASA_0558: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Tolumonas auensis DSM 9187

Gene: Tola_2915: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 2.
zip
*
Psychromonas ingrahamii 37

Site:
position = -52
score = 6.56523
sequence = TAAGTGTTATAATATAACAAAAT

Site:
position = -91
score = 5.9524
sequence = TAAGTGTTATATTATAACACTTA

Gene: Ping_3634: Predicted zinc transporter, ZIP family
*
Psychromonas sp. CNPT3

Site:
position = -55
score = 4.98126
sequence = TTTTTGTTATATTATAACACTTT

Gene: PCNPT3_01665: Predicted zinc transporter, ZIP family
*
Moritella sp. PE36

Site:
position = -91
score = 5.85326
sequence = GAATTGTTATAATATAACAATTC

Site:
position = -52
score = 5.05465
sequence = CGACTGTTATGTTATATTATAAC

Gene: PE36_16004: Predicted zinc transporter, ZIP family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
Predicted zinc transporter, ZIP family
 
CRON 3.
yciC
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
*
Moritella sp. PE36

Site:
position = -66
score = 6.77883
sequence = TAAATGTTATGTTATAACATAAC

Gene: PE36_23371: cobalamin synthesis protein/P47K family protein
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
cobalamin synthesis protein/P47K family protein
 
CRON 4.
folE2
 
Psychromonas ingrahamii 37

Gene: Ping_0923: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Psychromonas sp. CNPT3

Gene: PCNPT3_10393: GTP cyclohydrolase I (EC 3.5.4.16) type 2
*
Moritella sp. PE36

Site:
position = -39
score = 6.77883
sequence = TAATTGTTATGTTATAACATAAC

Gene: PE36_11622: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
CRON 5.
rpmE
 
Psychromonas ingrahamii 37
*
Psychromonas sp. CNPT3

Site:
position = -37
score = 7.06493
sequence = TAAGTGTTATGTTATAACATAAC

Gene: PCNPT3_03847: LSU ribosomal protein L31p
*
Moritella sp. PE36

Site:
position = -37
score = 6.86891
sequence = TGGGTGTTATGTTATAACATAAC

Gene: PE36_07292: LSU ribosomal protein L31p
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -41
score = 5.907
sequence = TATTTGTTATGTTATAACAACTA

Gene: AHA_1911: LSU ribosomal protein L31p
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -42
score = 6.40182
sequence = TAATTGTTATAAGATAACATATC

Gene: ASA_2374: LSU ribosomal protein L31p
 
Tolumonas auensis DSM 9187
LSU ribosomal protein L31p
rpmJ
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3

Gene: PCNPT3_03852: 50S ribosomal protein L36
 
Moritella sp. PE36

Gene: PE36_07287: 50S ribosomal protein L36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_1910: 50S ribosomal protein L36
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_2375: 50S ribosomal protein L36
*
Tolumonas auensis DSM 9187

Site:
position = -43
score = 6.0566
sequence = AATATGTTACGTTATAACATATC

Gene: Tola_0309: 50S ribosomal protein L36
50S ribosomal protein L36
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD