Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c 14 7
Alteromonas macleodii 'Deep ecotype' 7 5
Glaciecola sp. HTCC2999 2 2
Colwellia psychrerythraea 34H 4 4
Alteromonadales bacterium TW-7 11 6
Pseudoalteromonas haloplanktis TAC125 3 3
Pseudoalteromonas tunicata D2 6 4
Idiomarina baltica OS145 2 2
Idiomarina loihiensis L2TR 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
COG4525
*
Pseudoalteromonas atlantica T6c

Site:
position = -32
score = 6.18822
sequence = ATTATGTTATATTATAACGATAC

Site:
position = -62
score = 5.7517
sequence = TTATCGTTATAATATAACATAGC

Gene: Patl_3773: ABC transporter ATP-binding protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -50
score = 5.21201
sequence = GTAATAATATAACATTACAACAC

Site:
position = -55
score = 6.05488
sequence = TTATGGTAATAATATAACATTAC

Gene: MADE_01807: ABC transporter ATP-binding protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -56
score = 5.96608
sequence = GAGTTGTTATAGTATAACATCCC

Gene: ATW7_12973: ABC transporter ATP-binding protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
ABC transporter ATP-binding protein
COG1277
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3774: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01806: hypothetical protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_12968: hypothetical protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
PF12040
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3775: Gll1302 protein
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_01805: Gll1302 protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_12963: Gll1302 protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Gll1302 protein
foxA
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3776: TonB-dependent siderophore receptor
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7

Gene: ATW7_12958: TonB-dependent siderophore receptor
 
Pseudoalteromonas haloplanktis TAC125

Gene: PSHAa1584: TonB-dependent siderophore receptor
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
TonB-dependent siderophore receptor
 
CRON 2.
omr
*2
Pseudoalteromonas atlantica T6c

Site:
position = -55
score = 6.30826
sequence = TTGGTGTTATATTATAACATCAC

Gene: Patl_3627: Zinc-regulated outer membrane receptor

Gene: Patl_2604: Zinc-regulated outer membrane receptor
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -52
score = 5.43302
sequence = AAAATGTTATAACATCACTAAAT

Gene: MADE_03676: Zinc-regulated outer membrane receptor
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -85
score = 6.04188
sequence = TAAAAGTTATAGTATAACATTGT

Site:
position = -47
score = 4.99413
sequence = GAACTGTTATATTATATCACAAC

Gene: ATW7_07102: Zinc-regulated outer membrane receptor
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -48
score = 5.25736
sequence = GTAGTGTTATATTATATCACAAC

Site:
position = -86
score = 6.28484
sequence = ATAAGGTTATACTATAACATCAT

Gene: PSHAa1415: Zinc-regulated outer membrane receptor
*
Pseudoalteromonas tunicata D2

Site:
position = -83
score = 5.62876
sequence = CAAATGTTATAGCATCACAGTTG

Site:
position = -43
score = 5.04816
sequence = GTAATGTTACACTATCTCAATTG

Gene: PTD2_19912: Zinc-regulated outer membrane receptor
*
Idiomarina baltica OS145

Site:
position = -67
score = 6.52485
sequence = GTAATGTTATATTATCACATTAA

Gene: OS145_12066: Zinc-regulated outer membrane receptor
*
Idiomarina loihiensis L2TR

Site:
position = -64
score = 6.2914
sequence = GTAATGTTATATTATTACAATAA

Gene: IL1028: Zinc-regulated outer membrane receptor
Zinc-regulated outer membrane receptor
 
CRON 3.
omr2
 
Pseudoalteromonas atlantica T6c
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -25
score = 5.81786
sequence = AAAATGAGATAACATAACATCAC

Gene: MADE_01528: Zinc-regulated outer membrane receptor
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
*
Idiomarina loihiensis L2TR

Site:
position = -56
score = 6.79845
sequence = TTATTGTTATAATATAACATTAC

Gene: IL2588: Zinc-regulated outer membrane receptor
Zinc-regulated outer membrane receptor
 
CRON 4.
PF11736
*
Pseudoalteromonas atlantica T6c

Site:
position = -67
score = 5.62825
sequence = CTATTGATATGTTATAACATTTA

Gene: Patl_0305: lipoprotein, putative
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007807: lipoprotein, putative
*
Colwellia psychrerythraea 34H

Site:
position = -60
score = 5.87669
sequence = TTTATGTTATGTTATAACATTGA

Gene: CPS_1814: lipoprotein, putative
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
lipoprotein, putative
 
CRON 5.
PF05787
*
Pseudoalteromonas atlantica T6c

Site:
position = -58
score = 5.84936
sequence = ATTATGTGATAACATAACATTTT

Gene: Patl_0331: hypothetical protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -87
score = 5.50597
sequence = ATGTTGTTATAGTGTAACAATAT

Gene: MADE_00705: hypothetical protein
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
 
CRON 6.
zbp
*
Pseudoalteromonas atlantica T6c

Site:
position = -204
score = 5.37397
sequence = GTGATGTTATATTGTATCATTTA

Site:
position = -175
score = 4.86742
sequence = GTTATGTTATATTGTAACCAATT

Gene: Patl_0296: Predicted zinc-binding protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100007797: Predicted zinc-binding protein
 
Colwellia psychrerythraea 34H

Gene: CPS_1817: Predicted zinc-binding protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Predicted zinc-binding protein
zur2
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0297: Zinc uptake regulation protein paralog
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
*
Alteromonadales bacterium TW-7

Site:
position = -146
score = 5.09497
sequence = TAGATGTTATATTGTATCAATTG

Site:
position = -118
score = 5.88608
sequence = TATATGTTATATTATATCAATAG

Gene: ATW7_16049: Zinc uptake regulation protein paralog
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Zinc uptake regulation protein paralog
Patl_0298
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0298: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1818: hypothetical protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_16044: hypothetical protein
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
yciC
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0299: Putative metal chaperone, GTPase of COG0523 family
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1815: Putative metal chaperone, GTPase of COG0523 family
*
Alteromonadales bacterium TW-7

Site:
position = -51
score = 6.06735
sequence = ATATTGATATAATATAACATATC

Gene: ATW7_09166: Putative metal chaperone, GTPase of COG0523 family
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Putative metal chaperone, GTPase of COG0523 family
PF08856
 
Pseudoalteromonas atlantica T6c

Gene: Patl_0300: hypothetical protein
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1816: hypothetical protein
 
Alteromonadales bacterium TW-7

Gene: ATW7_09171: hypothetical protein
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -39
score = 5.77924
sequence = CTTTTGATATATTATCACATAAC

Gene: PTD2_00701: hypothetical protein
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
hypothetical protein
 
CRON 7.
ribA
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H

Gene: CPS_1824: GTP cyclohydrolase II (EC 3.5.4.25)
*
Alteromonadales bacterium TW-7

Site:
position = -59
score = 5.23254
sequence = CTTTTGTGATACTATCACTTTAT

Gene: ATW7_11681: GTP cyclohydrolase II (EC 3.5.4.25)
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -59
score = 5.40053
sequence = CTTTTGTGATAATATCACTTCAT

Gene: PSHAa0529: GTP cyclohydrolase II (EC 3.5.4.25)
*2
Pseudoalteromonas tunicata D2

Gene: PTD2_14452: GTP cyclohydrolase II (EC 3.5.4.25)

Site:
position = -47
score = 6.04541
sequence = CTTTTGTTATATTATCACAATAT

Gene: PTD2_14447: GTP cyclohydrolase II (EC 3.5.4.25)
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
GTP cyclohydrolase II (EC 3.5.4.25)
 
CRON 8.
PF03203
*
Pseudoalteromonas atlantica T6c

Site:
position = -45
score = 6.16751
sequence = TTGATGTTATATTATAACGTTCA

Gene: Patl_3486: MerC-like membrane protein
*
Alteromonas macleodii 'Deep ecotype'

Site:
position = -163
score = 5.41246
sequence = AGTCTGTTATAATATAACGTCTC

Gene: MADE_00546: MerC-like membrane protein
*
Glaciecola sp. HTCC2999

Site:
position = -49
score = 6.27493
sequence = TTTATGTTATACTATAACATCGA

Gene: GHTCC_010100002164: MerC-like membrane protein
*
Colwellia psychrerythraea 34H

Site:
position = -94
score = 5.96206
sequence = CTAATGTTATATTATATCAATTG

Gene: CPS_0396: MerC-like membrane protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
*
Idiomarina baltica OS145

Site:
position = -43
score = 5.73465
sequence = CGTATGTTATAATATAACAGGCT

Gene: OS145_08107: MerC-like membrane protein
*
Idiomarina loihiensis L2TR

Site:
position = -50
score = 5.7462
sequence = CGTATGTTATAATATTACAGCTT

Gene: IL2274: MerC-like membrane protein
MerC-like membrane protein
 
CRON 9.
PF11751
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
*
Colwellia psychrerythraea 34H

Site:
position = -191
score = 5.29884
sequence = TACTTGTTATAGTATAACACTTA

Gene: CPS_4490: Putative exported protein
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Putative exported protein
 
CRON 10.
omr1
*
Pseudoalteromonas atlantica T6c

Site:
position = -65
score = 5.45275
sequence = AATTGGTTACAATATAACATAAC

Site:
position = -36
score = 6.16436
sequence = TAAATGATACAATATAACATCAC

Gene: Patl_0295: Zinc-regulated outer membrane receptor
 
Alteromonas macleodii 'Deep ecotype'
*
Glaciecola sp. HTCC2999

Site:
position = -53
score = 6.25882
sequence = GTAATGTGATATTATAACATTTC

Gene: GHTCC_010100001624: Zinc-regulated outer membrane receptor
*
Colwellia psychrerythraea 34H

Site:
position = -194
score = 6.44099
sequence = ATAATGTGATAATATAACATTAT

Site:
position = -169
score = 5.4576
sequence = AAATTGTTACATTATCACATTGG

Gene: CPS_1902: Zinc-regulated outer membrane receptor
*
Alteromonadales bacterium TW-7

Site:
position = -36
score = 5.70791
sequence = CAATTGATACAATATAACATCTA

Site:
position = -64
score = 6.04821
sequence = CTATTGATATAATATAACATATA

Gene: ATW7_16054: Zinc-regulated outer membrane receptor
 
Pseudoalteromonas haloplanktis TAC125
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Zinc-regulated outer membrane receptor
 
CRON 11.
rpmE2
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
 
Pseudoalteromonas haloplanktis TAC125
*
Pseudoalteromonas tunicata D2

Site:
position = -34
score = 5.68876
sequence = GTTATGATATACTATCACATAAT

Gene: PTD2_02796: LSU ribosomal protein L31p
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
LSU ribosomal protein L31p
rpmJ
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -73
score = 5.64342
sequence = AAAATGATACAATATCACATAAC

Gene: PSHAb0382: LSU ribosomal protein L36p
 
Pseudoalteromonas tunicata D2

Gene: PTD2_02801: LSU ribosomal protein L36p
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
LSU ribosomal protein L36p
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD