Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 62 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 13 6
Vibrio vulnificus CMCP6 13 7
Vibrio harveyi ATCC BAA-1116 9 5
Vibrio parahaemolyticus RIMD 2210633 16 7
Vibrio shilonii AK1 14 8
Vibrio splendidus LGP32 11 6
Vibrio fischeri ES114 11 6
Vibrio salmonicida LFI1238 11 5
Vibrio angustum S14 6 4
Photobacterium profundum SS9 10 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
VC2551
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -50
score = 5.14441
sequence = GACTTGTTATATTATAACAAGCC

Gene: VC2551: hypothetical protein
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -43
score = 5.26494
sequence = TGAGTGTTATATTATAACACCCG

Gene: VP0303: hypothetical protein
 
Vibrio shilonii AK1
*
Vibrio splendidus LGP32

Site:
position = -53
score = 6.21452
sequence = ATATTGTTATATTATAACAGTAT

Gene: VS_2780: hypothetical protein
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -48
score = 6.37102
sequence = AAAATGTTATATTATTACATTTA

Gene: VSAL_I0429: hypothetical protein
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -25
score = 6.16298
sequence = GTAATGTTATATTATTACATTAC

Gene: PBPRA0375: hypothetical protein
hypothetical protein
zbp
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2552: Predicted zinc-binding protein
*
Vibrio vulnificus CMCP6

Site:
position = -381
score = 5.58896
sequence = TAGCTGTTATATTGTAACACTTT

Gene: VV1_0717: Predicted zinc-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00774: Predicted zinc-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0302: Predicted zinc-binding protein
*
Vibrio shilonii AK1

Site:
position = -391
score = 5.93767
sequence = GATTTGTTATAACATAACAAATC

Gene: VSAK1_01829: Predicted zinc-binding protein
 
Vibrio splendidus LGP32

Gene: VS_2781: Predicted zinc-binding protein
*
Vibrio fischeri ES114

Site:
position = -389
score = 6.37102
sequence = AAAATGTTATATTATTACATTTA

Gene: VF_0328: Predicted zinc-binding protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0428: Predicted zinc-binding protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA0374: Predicted zinc-binding protein
Predicted zinc-binding protein
 
CRON 2.
rpmE2
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -40
score = 6.86119
sequence = AAAATGTTATAACATAACAATTT

Gene: VC0878: LSU ribosomal protein L31p
*
Vibrio vulnificus CMCP6

Site:
position = -37
score = 6.68323
sequence = AATATGTTATAACATAACAATTA

Gene: VV1_1840: LSU ribosomal protein L31p
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -41
score = 6.57735
sequence = ATAATGTTATAACATAACAATCA

Gene: VIBHAR_03250: LSU ribosomal protein L31p
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -41
score = 6.86119
sequence = AAAATGTTATAACATAACAATTT

Gene: VP2331: LSU ribosomal protein L31p
*
Vibrio shilonii AK1

Site:
position = -31
score = 6.53457
sequence = GCAATGTTATAACATAACAATTA

Gene: VSAK1_20814: LSU ribosomal protein L31p
*
Vibrio splendidus LGP32

Site:
position = -43
score = 5.60552
sequence = GATATGTTATAACGTATCAAATT

Gene: VS_2366: LSU ribosomal protein L31p
 
Vibrio fischeri ES114
*
Vibrio salmonicida LFI1238

Site:
position = -47
score = 6.7011
sequence = GTTATGTTATAACATAACAATTA

Gene: VSAL_I0890: LSU ribosomal protein L31p
*
Vibrio angustum S14

Site:
position = -43
score = 6.62971
sequence = GTTATGTTATAACATAACAATAA

Gene: VAS14_13584: LSU ribosomal protein L31p
 
Photobacterium profundum SS9
LSU ribosomal protein L31p
rpmJ2
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC0879: LSU ribosomal protein L36p
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_03249: LSU ribosomal protein L36p
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP2330: LSU ribosomal protein L36p
 
Vibrio shilonii AK1

Gene: VSAK1_20809: LSU ribosomal protein L36p
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0889: LSU ribosomal protein L36p
 
Vibrio angustum S14

Gene: VAS14_13579: LSU ribosomal protein L36p
 
Photobacterium profundum SS9
LSU ribosomal protein L36p
 
CRON 3.
ribA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -97
score = 6.18284
sequence = CATTTGTTATAACATAACAATTT

Gene: VC1263: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio vulnificus CMCP6

Site:
position = -144
score = 6.08321
sequence = TTATTGTTATAATATAACAAAAC

Gene: VV1_2234: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -154
score = 6.56042
sequence = TAAATGTTATATTATAACAATTG

Gene: VIBHAR_02717: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -207
score = 6.24594
sequence = AAATTGTTATACTATAACAATTT

Gene: VP1921: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio shilonii AK1

Site:
position = -91
score = 6.63558
sequence = TAATTGTTATAATATAACAATTA

Gene: VSAK1_04575: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio splendidus LGP32

Site:
position = -116
score = 6.65548
sequence = TAATTGTTATAATATAACAATTT

Gene: VS_1924: GTP cyclohydrolase II (EC 3.5.4.25)
 
Vibrio fischeri ES114

Gene: VF_1189: GTP cyclohydrolase II (EC 3.5.4.25)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1787: GTP cyclohydrolase II (EC 3.5.4.25)
*
Vibrio angustum S14

Site:
position = -260
score = 6.19201
sequence = GATGTGTTATAATATAACATATT

Gene: VAS14_03723: GTP cyclohydrolase II (EC 3.5.4.25)
 2
Photobacterium profundum SS9

Gene: PBPRA1519: GTP cyclohydrolase II (EC 3.5.4.25)

Gene: PBPRA1520: GTP cyclohydrolase II (EC 3.5.4.25)
GTP cyclohydrolase II (EC 3.5.4.25)
 
CRON 4.
omr
 
Vibrio cholerae O1 biovar eltor str. N16961
*
Vibrio vulnificus CMCP6

Site:
position = -125
score = 6.65423
sequence = GAAATGTTATAACATAACATTTG

Gene: VV1_0360: predicted zinc-related TonB-dependent outer membrane transporter
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -36
score = 4.83677
sequence = GTGGTGTAATAACATAACAAAGT

Site:
position = -70
score = 5.25222
sequence = TCTTTGTTATGTTATAACATCTG

Gene: VIBHAR_06466: predicted zinc-related TonB-dependent outer membrane transporter
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -62
score = 6.16968
sequence = TAATTGTTATATTATAACAACTT

Site:
position = -33
score = 6.31617
sequence = CATATGTTATAACATAACAATAA

Gene: VPA1308: predicted zinc-related TonB-dependent outer membrane transporter
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
predicted zinc-related TonB-dependent outer membrane transporter
znuA2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_0359: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06465: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1307: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuB2
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio vulnificus CMCP6

Gene: VV1_0358: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06464: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA1306: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 5.
znuC
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -47
score = 5.54101
sequence = TGAATGTTACTTTATAACATAAC

Gene: VC2082: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio vulnificus CMCP6

Site:
position = -46
score = 6.25895
sequence = AAAATGTTACATTATAACACTCA

Gene: VV1_0152: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -46
score = 6.72922
sequence = ATAATGTTACATTATAACATTAT

Gene: VIBHAR_01360: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -46
score = 6.72922
sequence = ATAATGTTACATTATAACATTAT

Gene: VP0852: Zinc ABC transporter, ATP-binding protein ZnuC
*2
Vibrio shilonii AK1

Site:
position = -46
score = 6.61285
sequence = GAAATGTTACATTATAACAATAA

Gene: VSAK1_08973: Zinc ABC transporter, ATP-binding protein ZnuC

Site:
position = -102
score = 6.33008
sequence = GTTATGTTATAACATAACTTTTA

Gene: VSAK1_17572: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio splendidus LGP32

Site:
position = -46
score = 6.38187
sequence = TAAATGTTACATTATAACATTAG

Gene: VS_2238: Zinc ABC transporter, ATP-binding protein ZnuC
*2
Vibrio fischeri ES114

Site:
position = -50
score = 6.55182
sequence = AAAATGTTACATTATAACACTTA

Gene: VF_0829: Zinc ABC transporter, ATP-binding protein ZnuC

Site:
position = -90
score = 6.7011
sequence = GTTATGTTATAACATAACAATTA

Gene: VF_2367: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio salmonicida LFI1238

Site:
position = -50
score = 6.55182
sequence = AAAATGTTACATTATAACACTTA

Gene: VSAL_I0851: Zinc ABC transporter, ATP-binding protein ZnuC
*
Vibrio angustum S14

Site:
position = -83
score = 6.33806
sequence = ATAATGTTACAATATAACATATC

Site:
position = -59
score = 6.70743
sequence = GTAATGTTATATTATAACATTAC

Gene: VAS14_17781: Zinc ABC transporter, ATP-binding protein ZnuC
*
Photobacterium profundum SS9

Site:
position = -55
score = 6.01422
sequence = GTGATGTTATAATATAACACCTT

Gene: PBPRA1054: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2083: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio vulnificus CMCP6

Gene: VV1_0153: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01359: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0851: Zinc ABC transporter, inner membrane permease protein ZnuB
 2
Vibrio shilonii AK1

Gene: VSAK1_08968: Zinc ABC transporter, inner membrane permease protein ZnuB

Gene: VSAK1_17577: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio splendidus LGP32

Gene: VS_2239: Zinc ABC transporter, inner membrane permease protein ZnuB
 2
Vibrio fischeri ES114

Gene: VF_0828: Zinc ABC transporter, inner membrane permease protein ZnuB

Gene: VF_2368: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0850: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Vibrio angustum S14

Gene: VAS14_17776: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Photobacterium profundum SS9

Gene: PBPRA1053: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 6.
znuA
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -50
score = 5.88078
sequence = GTTATGTTATAAAGTAACATTCA

Gene: VC2081: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio vulnificus CMCP6

Site:
position = -58
score = 6.30927
sequence = TGAGTGTTATAATGTAACATTTT

Gene: VV1_0151: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -55
score = 6.77341
sequence = ATAATGTTATAATGTAACATTAT

Gene: VIBHAR_01361: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -55
score = 6.77341
sequence = ATAATGTTATAATGTAACATTAT

Gene: VP0853: Zinc ABC transporter, periplasmic-binding protein ZnuA
*2
Vibrio shilonii AK1

Site:
position = -64
score = 6.46857
sequence = GTTATGTTATAACATAACAATTG

Gene: VSAK1_17567: Zinc ABC transporter, periplasmic-binding protein ZnuA

Site:
position = -58
score = 6.37977
sequence = TTATTGTTATAATGTAACATTTC

Gene: VSAK1_08978: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio splendidus LGP32

Site:
position = -60
score = 6.52923
sequence = CTAATGTTATAATGTAACATTTA

Gene: VS_2237: Zinc ABC transporter, periplasmic-binding protein ZnuA
*2
Vibrio fischeri ES114

Site:
position = -79
score = 6.7011
sequence = GTTATGTTATAACATAACAATTA

Gene: VF_2366: Zinc ABC transporter, periplasmic-binding protein ZnuA

Site:
position = -61
score = 6.46378
sequence = TAAGTGTTATAATGTAACATTTT

Gene: VF_0830: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio salmonicida LFI1238

Site:
position = -61
score = 6.46378
sequence = TAAGTGTTATAATGTAACATTTT

Gene: VSAL_I0852: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Vibrio angustum S14

Site:
position = -133
score = 6.77468
sequence = GTAATGTTATAATATAACATTAC

Site:
position = -109
score = 6.50813
sequence = GATATGTTATATTGTAACATTAT

Gene: VAS14_17786: Zinc ABC transporter, periplasmic-binding protein ZnuA
*2
Photobacterium profundum SS9

Site:
position = 24
score = 5.59719
sequence = AAGGTGTTATATTATAACATCAC

Gene: PBPRA1055: Zinc ABC transporter, periplasmic-binding protein ZnuA

Gene: PBPRA1056: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 7.
VC2551
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -50
score = 5.14441
sequence = GACTTGTTATATTATAACAAGCC

Gene: VC2551: hypothetical protein
 
Vibrio vulnificus CMCP6
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -43
score = 5.26494
sequence = TGAGTGTTATATTATAACACCCG

Gene: VP0303: hypothetical protein
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
hypothetical protein
zbp
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2552: Predicted zinc-binding protein
*
Vibrio vulnificus CMCP6

Site:
position = -381
score = 5.58896
sequence = TAGCTGTTATATTGTAACACTTT

Gene: VV1_0717: Predicted zinc-binding protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00774: Predicted zinc-binding protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0302: Predicted zinc-binding protein
*
Vibrio shilonii AK1

Site:
position = -391
score = 5.93767
sequence = GATTTGTTATAACATAACAAATC

Gene: VSAK1_01829: Predicted zinc-binding protein
*
Vibrio splendidus LGP32

Site:
position = -385
score = 6.21452
sequence = ATATTGTTATATTATAACAGTAT

Gene: VS_2781: Predicted zinc-binding protein
*
Vibrio fischeri ES114

Site:
position = -389
score = 6.37102
sequence = AAAATGTTATATTATTACATTTA

Gene: VF_0328: Predicted zinc-binding protein
*
Vibrio salmonicida LFI1238

Site:
position = -390
score = 6.37102
sequence = AAAATGTTATATTATTACATTTA

Gene: VSAL_I0428: Predicted zinc-binding protein
 
Vibrio angustum S14
*
Photobacterium profundum SS9

Site:
position = -376
score = 6.16298
sequence = GTAATGTTATATTATTACATTAC

Gene: PBPRA0374: Predicted zinc-binding protein
Predicted zinc-binding protein
VV1_0719
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2553: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio vulnificus CMCP6

Gene: VV1_0719: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00773: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0301: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio shilonii AK1

Gene: VSAK1_01824: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio splendidus LGP32

Gene: VS_2782: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio fischeri ES114

Gene: VF_0327: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0427: ABC-type antimicrobial peptide transport system, ATPase component
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA0373: ABC-type antimicrobial peptide transport system, ATPase component
ABC-type antimicrobial peptide transport system, ATPase component
VC2554
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2554: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio vulnificus CMCP6

Gene: VV1_0720: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00772: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0300: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio shilonii AK1

Gene: VSAK1_01819: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio splendidus LGP32

Gene: VS_2783: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio fischeri ES114

Gene: VF_0326: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0426: ABC-type antimicrobial peptide transport system, permease component
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA0372: ABC-type antimicrobial peptide transport system, permease component
ABC-type antimicrobial peptide transport system, permease component
VC2555
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC2555: FIG003461: hypothetical protein
 
Vibrio vulnificus CMCP6

Gene: VV1_0721: FIG003461: hypothetical protein
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_00771: FIG003461: hypothetical protein
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP0299: FIG003461: hypothetical protein
 
Vibrio shilonii AK1

Gene: VSAK1_01814: FIG003461: hypothetical protein
 
Vibrio splendidus LGP32

Gene: VS_2784: FIG003461: hypothetical protein
 
Vibrio fischeri ES114

Gene: VF_0325: FIG003461: hypothetical protein
 
Vibrio salmonicida LFI1238

Gene: VSAL_I0425: FIG003461: hypothetical protein
 
Vibrio angustum S14
 
Photobacterium profundum SS9

Gene: PBPRA0371: FIG003461: hypothetical protein
FIG003461: hypothetical protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD