Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Desulfuromonadales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Geobacter metallireducens GS-15
Geobacter sulfurreducens PCA
Geobacter uraniumreducens Rf4 2 1
Geobacter sp. FRC-32 2 1
Geobacter sp. M21 2 1
Geobacter lovleyi SZ 2 1
Pelobacter propionicus DSM 2379 3 1
Pelobacter carbinolicus str. DSM 2380 2 1
Desulfuromonas acetoxidans DSM 684
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sahR
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
*
Geobacter uraniumreducens Rf4

Site:
position = -41
score = 5.54506
sequence = AAATCAAGAAAAACTGATAT

Gene: Gura_3006: Transcriptional regulator of methionine metabolism, ArsR family
*
Geobacter sp. FRC-32

Site:
position = -41
score = 6.10119
sequence = ATATCAAGAAAAATTGATAT

Gene: Geob_2249: Transcriptional regulator of methionine metabolism, ArsR family
*
Geobacter sp. M21

Site:
position = -45
score = 5.64132
sequence = ATATCAAGGAAACTTGATTT

Gene: GM21_2939: Transcriptional regulator of methionine metabolism, ArsR family
*
Geobacter lovleyi SZ

Site:
position = -43
score = 6.10119
sequence = ATATCAAGAAAAGTTGATAT

Gene: Glov_0357: Transcriptional regulator of methionine metabolism, ArsR family
*
Pelobacter propionicus DSM 2379

Site:
position = -48
score = 5.56505
sequence = ATATCAAGAATACTTGATGT

Gene: Ppro_0039: Transcriptional regulator of methionine metabolism, ArsR family
*
Pelobacter carbinolicus str. DSM 2380

Site:
position = -43
score = 6.10119
sequence = ATATCAAGAAAAGTTGATAT

Gene: Pcar_1925: Transcriptional regulator of methionine metabolism, ArsR family
 
Desulfuromonas acetoxidans DSM 684
Transcriptional regulator of methionine metabolism, ArsR family
Ppro_0040
 
Geobacter metallireducens GS-15
 
Geobacter sulfurreducens PCA
 
Geobacter uraniumreducens Rf4
 
Geobacter sp. FRC-32
 
Geobacter sp. M21
 
Geobacter lovleyi SZ
 
Pelobacter propionicus DSM 2379

Gene: Ppro_0040: tRNA (5-methoxyuridine) 34 synthase
 
Pelobacter carbinolicus str. DSM 2380
 
Desulfuromonas acetoxidans DSM 684
tRNA (5-methoxyuridine) 34 synthase
ahcY
 
Geobacter metallireducens GS-15

Gene: Gmet_1294: Adenosylhomocysteinase (EC 3.3.1.1)
 
Geobacter sulfurreducens PCA

Gene: GSU1875: Adenosylhomocysteinase (EC 3.3.1.1)
 
Geobacter uraniumreducens Rf4

Gene: Gura_3005: Adenosylhomocysteinase (EC 3.3.1.1)
 
Geobacter sp. FRC-32

Gene: Geob_2250: Adenosylhomocysteinase (EC 3.3.1.1)
 
Geobacter sp. M21

Gene: GM21_2938: Adenosylhomocysteinase (EC 3.3.1.1)
 
Geobacter lovleyi SZ

Gene: Glov_0356: Adenosylhomocysteinase (EC 3.3.1.1)
 
Pelobacter propionicus DSM 2379

Gene: Ppro_0041: Adenosylhomocysteinase (EC 3.3.1.1)
 
Pelobacter carbinolicus str. DSM 2380

Gene: Pcar_1924: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfuromonas acetoxidans DSM 684

Gene: Dace_1960: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD