Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 8 4
Caulobacter segnis ATCC 21756 8 4
Caulobacter sp. K31 11 3
Phenylobacterium zucineum HLK1 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metK
*
Caulobacter crescentus CB15

Site:
position = -90
score = 6.59176
sequence = GCATAAACATATCTTTATAT

Gene: CC0050: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Caulobacter segnis ATCC 21756

Site:
position = -85
score = 6.59176
sequence = GCATAAACATATCTTTATAT

Gene: Cseg_0024: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Caulobacter sp. K31

Site:
position = -83
score = 6.35648
sequence = ACATAAACTTATCTTTATAT

Gene: Caul_0027: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Phenylobacterium zucineum HLK1

Site:
position = -84
score = 6.14273
sequence = ACATAAAGATTTCTTTATAG

Gene: PHZ_c3448: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
 
CRON 2.
metE
*
Caulobacter crescentus CB15

Site:
position = -393
score = 6.67031
sequence = ACATAAAGAAATCTTTATAT

Gene: CC0482: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
CRON 3.
ahcY
*
Caulobacter crescentus CB15

Site:
position = -90
score = 6.62798
sequence = ACATAAAGATATCTTTATGC

Gene: CC0257: Adenosylhomocysteinase (EC 3.3.1.1)
*
Caulobacter segnis ATCC 21756

Site:
position = -86
score = 5.77583
sequence = GCATAAGGATATCTTTATGC

Gene: Cseg_0217: Adenosylhomocysteinase (EC 3.3.1.1)
*
Caulobacter sp. K31

Site:
position = -91
score = 5.81816
sequence = ATATAAAGAAATCCTTATGC

Gene: Caul_4623: Adenosylhomocysteinase (EC 3.3.1.1)
*
Phenylobacterium zucineum HLK1

Site:
position = -88
score = 6.13446
sequence = ACATAAAGACTTCTTTATAT

Gene: PHZ_c0093: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
 
CRON 4.
DUF1852
 
Caulobacter crescentus CB15
*
Caulobacter segnis ATCC 21756

Site:
position = -362
score = 6.3927
sequence = ACATAAAGATATCCTTATGT

Gene: Cseg_1811: Protein of unknown function DUF1852
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
Protein of unknown function DUF1852
metE2
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1810: methionine synthase
 
Caulobacter sp. K31
 
Phenylobacterium zucineum HLK1
methionine synthase
 
CRON 5.
sahR
*
Caulobacter crescentus CB15

Site:
position = -24
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: CC2141: Transcriptional regulator of methionine metabolism, ArsR family
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -24
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: Caul_3410: Transcriptional regulator of methionine metabolism, ArsR family
*
Phenylobacterium zucineum HLK1

Site:
position = -26
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: PHZ_c2652: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metF
 
Caulobacter crescentus CB15

Gene: CC2140: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Caulobacter segnis ATCC 21756

Site:
position = -1000
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: Cseg_1280: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Caulobacter sp. K31

Gene: Caul_3409: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2651: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
CC2139
 
Caulobacter crescentus CB15

Gene: CC2139: metallo-beta-lactamase superfamily protein
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1281: metallo-beta-lactamase superfamily protein
 
Caulobacter sp. K31

Gene: Caul_3408: metallo-beta-lactamase superfamily protein
 
Phenylobacterium zucineum HLK1
metallo-beta-lactamase superfamily protein
metH2
 
Caulobacter crescentus CB15

Gene: CC2138: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1282: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Caulobacter sp. K31

Gene: Caul_3407: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2650: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Caul_3406
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_3406: PIN domain protein
 
Phenylobacterium zucineum HLK1
PIN domain protein
Caul_3405
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_3405: PIN domain protein
 
Phenylobacterium zucineum HLK1
PIN domain protein
ddl
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_3404: D-alanine--D-alanine ligase B (EC 6.3.2.4)
 
Phenylobacterium zucineum HLK1
D-alanine--D-alanine ligase B (EC 6.3.2.4)
Caul_3403
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_3403: hypothetical protein
 
Phenylobacterium zucineum HLK1
hypothetical protein
metH
 
Caulobacter crescentus CB15

Gene: CC2137: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_1283: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Caulobacter sp. K31

Gene: Caul_3402: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2649: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD