Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Sphingomonadales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Erythrobacter litoralis HTCC2594 7 3
Erythrobacter sp. NAP1 6 3
Novosphingobium aromaticivorans DSM 12444 6 3
Sphingopyxis alaskensis RB2256 6 3
Sphingobium japonicum UT26S 6 3
Sphingomonas wittichii RW1 7 4
Zymomonas mobilis subsp. mobilis ZM4 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sahR
*
Erythrobacter litoralis HTCC2594

Site:
position = -18
score = 6.10685
sequence = ATATAACGATGTCTTTATAT

Gene: ELI_10100: Transcriptional regulator of methionine metabolism, ArsR family
*
Erythrobacter sp. NAP1

Site:
position = -40
score = 5.17127
sequence = ATTTACACATATCTAAATAT

Site:
position = -32
score = 5.61492
sequence = ATATCTAAATATCTTTATAT

Gene: NAP1_10493: Transcriptional regulator of methionine metabolism, ArsR family
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -48
score = 6.48688
sequence = ATATAAAGATATCTTTAAAC

Site:
position = -18
score = 6.2516
sequence = ATATAAAGGTTTCTTTATAT

Gene: Saro_3209: Transcriptional regulator of methionine metabolism, ArsR family
*
Sphingopyxis alaskensis RB2256

Site:
position = -28
score = 6.2516
sequence = ATATAAAGAAAGCTTTATAT

Gene: Sala_0034: Transcriptional regulator of methionine metabolism, ArsR family
*
Sphingobium japonicum UT26S

Site:
position = -29
score = 6.79532
sequence = ATATAAAGATTTCTTTATAT

Gene: SJA_C1-29170: Transcriptional regulator of methionine metabolism, ArsR family
*
Sphingomonas wittichii RW1

Site:
position = -16
score = 6.67031
sequence = ATATAAAGATTTCTTTATGT

Gene: Swit_2402: Transcriptional regulator of methionine metabolism, ArsR family
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -186
score = 6.53384
sequence = TCATAAAGATATCTTTATAT

Gene: ZMO1748: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metF
 
Erythrobacter litoralis HTCC2594

Gene: ELI_10095: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Erythrobacter sp. NAP1

Gene: NAP1_10488: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_3208: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0035: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Sphingobium japonicum UT26S

Gene: SJA_C1-29160: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Sphingomonas wittichii RW1

Gene: Swit_2401: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1747: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metH2
 
Erythrobacter litoralis HTCC2594

Gene: ELI_10090: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Erythrobacter sp. NAP1

Gene: NAP1_10483: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_3207: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0036: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingobium japonicum UT26S

Gene: SJA_C1-29150: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingomonas wittichii RW1

Gene: Swit_2400: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1746: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
ELI_10085
 
Erythrobacter litoralis HTCC2594

Gene: ELI_10085: GCN5-related N-acetyltransferase
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
 
Sphingomonas wittichii RW1
 
Zymomonas mobilis subsp. mobilis ZM4
GCN5-related N-acetyltransferase
metH
 
Erythrobacter litoralis HTCC2594

Gene: ELI_10080: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Erythrobacter sp. NAP1

Gene: NAP1_10478: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Novosphingobium aromaticivorans DSM 12444

Gene: Saro_3206: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingopyxis alaskensis RB2256

Gene: Sala_0037: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingobium japonicum UT26S

Gene: SJA_C1-29140: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Sphingomonas wittichii RW1

Gene: Swit_2399: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Zymomonas mobilis subsp. mobilis ZM4

Gene: ZMO1745: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
CRON 2.
metK
*
Erythrobacter litoralis HTCC2594

Site:
position = -49
score = 6.12659
sequence = ACATAAAGATTCCTTTATAT

Gene: ELI_14285: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Erythrobacter sp. NAP1

Site:
position = -80
score = 5.58287
sequence = ATATAAAGGTTTCCTTATGT

Gene: NAP1_11848: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -30
score = 6.12659
sequence = ACATAAAGGTTTCTTTATAT

Gene: Saro_0284: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Sphingopyxis alaskensis RB2256

Site:
position = -39
score = 5.58287
sequence = ACATAAAGCTTCCTTTATAT

Gene: Sala_3139: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Sphingobium japonicum UT26S

Site:
position = -53
score = 5.84036
sequence = ACATAAACTTTTCTTTATGT

Gene: SJA_C1-12140: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Sphingomonas wittichii RW1

Site:
position = -79
score = 5.71574
sequence = ATATAACGAAGTCTTTATAT

Gene: Swit_3373: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -187
score = 5.20808
sequence = ATATAAGGAAAGATTTATAT

Gene: ZMO0273: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
 
CRON 3.
metE
 
Erythrobacter litoralis HTCC2594
 
Erythrobacter sp. NAP1
 
Novosphingobium aromaticivorans DSM 12444
 
Sphingopyxis alaskensis RB2256
 
Sphingobium japonicum UT26S
*
Sphingomonas wittichii RW1

Site:
position = -558
score = 6.2516
sequence = ATATAAAGTTTTCTTTATAT

Gene: Swit_4786: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -316
score = 6.48935
sequence = ATATAAACACATCTTTATAT

Gene: ZMO1000: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
CRON 4.
ahcY
*
Erythrobacter litoralis HTCC2594

Site:
position = -110
score = 5.70788
sequence = ATATAAAGGAATCGTTATAT

Gene: ELI_05040: Adenosylhomocysteinase (EC 3.3.1.1)
*
Erythrobacter sp. NAP1

Site:
position = -115
score = 6.2516
sequence = ATATAAAGAAAACTTTATAT

Gene: NAP1_04180: Adenosylhomocysteinase (EC 3.3.1.1)
*
Novosphingobium aromaticivorans DSM 12444

Site:
position = -105
score = 6.25946
sequence = ATATAAAGAAGTCTTTATAT

Gene: Saro_2003: Adenosylhomocysteinase (EC 3.3.1.1)
*
Sphingopyxis alaskensis RB2256

Site:
position = -118
score = 6.09037
sequence = ATATAAAGAAAAGTTTATAT

Gene: Sala_0163: Adenosylhomocysteinase (EC 3.3.1.1)
*
Sphingobium japonicum UT26S

Site:
position = -120
score = 6.12659
sequence = ACATAAAGAAAACTTTATAT

Gene: SJA_C1-16830: Adenosylhomocysteinase (EC 3.3.1.1)
*
Sphingomonas wittichii RW1

Site:
position = -102
score = 6.2516
sequence = ATATAAAGAAACCTTTATAT

Gene: Swit_2674: Adenosylhomocysteinase (EC 3.3.1.1)
*
Zymomonas mobilis subsp. mobilis ZM4

Site:
position = -231
score = 5.7794
sequence = ACATAAAGAATTATTTATAT

Gene: ZMO0182: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD