Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 5 3
Magnetospirillum magnetotacticum MS-1 8 3
Magnetospirillum magneticum AMB-1 2 2
Azospirillum sp. B510 6 2
Rhodospirillum centenum SW 3 2
Gluconacetobacter diazotrophicus PAl 5 3 2
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metE
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -377
score = 6.79532
sequence = ATATAAAGATATCTTCATAT

Gene: Rru_A1718: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510
 
Rhodospirillum centenum SW
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -366
score = 5.06333
sequence = ATATAACAACATCCTTATAT

Gene: Gdia_0807: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -330
score = 6.56162
sequence = ACATAAAGATATATTTATAT

Gene: GbCGDNIH1_0783: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
CRON 2.
ahcY
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -70
score = 7.18643
sequence = ATATAAAGATATCTTTATAT

Gene: Rru_A3444: Adenosylhomocysteinase (EC 3.3.1.1)
*3
Magnetospirillum magnetotacticum MS-1

Site:
position = -89
score = 7.06142
sequence = ACATAAAGATATCTTTATAT

Gene: Magn03009486: Adenosylhomocysteinase (EC 3.3.1.1)

Gene: Magn03003856: Adenosylhomocysteinase (EC 3.3.1.1)

Gene: Magn03003857: Adenosylhomocysteinase (EC 3.3.1.1)
*
Magnetospirillum magneticum AMB-1

Site:
position = -89
score = 7.06142
sequence = ACATAAAGATATCTTTATAT

Gene: amb4391: Adenosylhomocysteinase (EC 3.3.1.1)
*
Azospirillum sp. B510

Site:
position = -134
score = 6.62798
sequence = ACATAAAGATATCTTTATGC

Gene: AZL_026520: Adenosylhomocysteinase (EC 3.3.1.1)
*
Rhodospirillum centenum SW

Site:
position = -163
score = 6.62798
sequence = ACATAAAGATATCTTTATGC

Gene: RC1_2714: Adenosylhomocysteinase (EC 3.3.1.1)
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_2130: Adenosylhomocysteinase (EC 3.3.1.1)
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_07710: Adenosylhomocysteinase (EC 3.3.1.1)
 
Gluconobacter oxydans 621H

Gene: GOX1078: Adenosylhomocysteinase (EC 3.3.1.1)
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -23
score = 6.0179
sequence = ATATAAATATATCCTTATGT

Gene: GbCGDNIH1_0064: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
 
CRON 3.
sahR
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -88
score = 7.18643
sequence = ATATAAAGATATCTTTATAT

Gene: Rru_A1529: Transcriptional regulator of methionine metabolism, ArsR family
*2
Magnetospirillum magnetotacticum MS-1

Site:
position = -46
score = 6.59176
sequence = GCATAAAGATATGTTTATAT

Gene: Magn03009308: Transcriptional regulator of methionine metabolism, ArsR family

Site:
position = -16
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: Magn03007315: Transcriptional regulator of methionine metabolism, ArsR family
*
Magnetospirillum magneticum AMB-1

Site:
position = -18
score = 6.59176
sequence = GCATAAAGATATGTTTATAT

Gene: amb0432: Transcriptional regulator of methionine metabolism, ArsR family
*
Azospirillum sp. B510

Site:
position = -60
score = 6.75299
sequence = GCATAAAGATATCTTTATAT

Gene: AZL_009180: Transcriptional regulator of methionine metabolism, ArsR family
*
Rhodospirillum centenum SW

Site:
position = -133
score = 6.40884
sequence = TCATAAAGATATCTTTATGT

Gene: RC1_2051: Transcriptional regulator of methionine metabolism, ArsR family
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -30
score = 5.06333
sequence = ATATAAGGATGTTGTTATAT

Gene: Gdia_0808: Transcriptional regulator of methionine metabolism, ArsR family
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -41
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: GbCGDNIH1_0152: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metF
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1530: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009307: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Gene: Magn03007314: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_009190: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Rhodospirillum centenum SW

Gene: RC1_2050: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_0809: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H

Gene: GOX2207: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0206: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
AZL_009200
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_009200: hypothetical protein
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
hypothetical protein
AZL_009210
 
Rhodospirillum rubrum ATCC 11170
 
Magnetospirillum magnetotacticum MS-1
 
Magnetospirillum magneticum AMB-1
 
Azospirillum sp. B510

Gene: AZL_009210: hypothetical protein
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1
hypothetical protein
metH
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1531: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 3
Magnetospirillum magnetotacticum MS-1

Gene: Magn03009306: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)

Gene: Magn03007313: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)

Gene: Magn03007312: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Magnetospirillum magneticum AMB-1

Gene: amb0429: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Azospirillum sp. B510

Gene: AZL_009220: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Rhodospirillum centenum SW
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_2881: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_24490: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Gluconobacter oxydans 621H

Gene: GOX2074: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0151: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD