Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444 5 1
Oceanicaulis alexandrii HTCC2633 7 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hom
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -202
score = 6.64271
sequence = ATATAAAGATATCCTTATAT

Gene: OA2633_08279: Homoserine dehydrogenase (EC 1.1.1.3)
Homoserine dehydrogenase (EC 1.1.1.3)
metX2
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08274: Homoserine O-acetyltransferase (EC 2.3.1.31)
Homoserine O-acetyltransferase (EC 2.3.1.31)
metB
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_5069: Cystathionine gamma-synthase (EC 2.5.1.48)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_08269: Cystathionine gamma-synthase (EC 2.5.1.48)
Cystathionine gamma-synthase (EC 2.5.1.48)
 
CRON 2.
metK
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3595: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Paracoccus denitrificans PD1222

Gene: Pden_1873: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Jannaschia sp. CCS1

Gene: Jann_0706: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_18193: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_13511: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_01171: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_14801: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Roseovarius nubinhibens ISM

Gene: ISM_00720: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Roseovarius sp. 217

Gene: ROS217_17232: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Sulfitobacter sp. EE-36

Gene: EE36_03448: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Silicibacter TM1040

Gene: TM1040_0193: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Silicibacter pomeroyi DSS-3

Gene: SPOA0011: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Roseobacter sp. MED193

Gene: MED193_17904: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0786: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -18
score = 6.10685
sequence = ATATAAAGATCGCTTTATAT

Gene: OA2633_10239: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
 
CRON 3.
sahR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
*
Hyphomonas neptunium ATCC 15444

Site:
position = -27
score = 5.04685
sequence = ATATAAAAGTTCGTTTATAT

Gene: HNE_2104: Transcriptional regulator of methionine metabolism, ArsR family
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_07429: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metF
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2172: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Paracoccus denitrificans PD1222

Gene: Pden_2319: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Jannaschia sp. CCS1

Gene: Jann_1026: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_08005: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_06424: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_15326: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_00765: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Roseovarius nubinhibens ISM

Gene: ISM_08350: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Roseovarius sp. 217

Gene: ROS217_15580: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Sulfitobacter sp. EE-36

Gene: EE36_03128: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Silicibacter TM1040

Gene: TM1040_1700: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3016: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Roseobacter sp. MED193

Gene: MED193_22231: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2103: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -18
score = 6.62798
sequence = GCATAAAGATATCTTTATGT

Gene: OA2633_05526: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metH2
 2
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2124: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)

Gene: RSP_3347: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1

Gene: Jann_2547: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 2
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20213: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)

Gene: RB2654_02050: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_03424: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_02517: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Roseovarius nubinhibens ISM

Gene: ISM_13465: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Roseovarius sp. 217

Gene: ROS217_19582: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Sulfitobacter sp. EE-36
 2
Silicibacter TM1040

Gene: TM1040_1468: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)

Gene: TM1040_3617: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Silicibacter pomeroyi DSS-3

Gene: SPO1884: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2102: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_05521: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
HNE_2101
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2101: hypothetical protein
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
metH
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_3346: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Paracoccus denitrificans PD1222

Gene: Pden_1935: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_20218: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53

Gene: SKA53_15401: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_3618: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_2100: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_05516: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD