Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 6 5
Rhizobium sp. NGR234 6 5
Rhizobium leguminosarum bv. viciae 3841 5 4
Rhizobium etli CFN 42 5 4
Agrobacterium tumefaciens str. C58 (Cereon) 5 4
Mesorhizobium sp. BNC1 4 3
Mesorhizobium loti MAFF303099 5 4
Brucella melitensis 16M 4 3
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571 4 2
Xanthobacter autotrophicus Py2 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metH2
 
Sinorhizobium meliloti 1021

Gene: SMc04342: 5-methyltetrahydrofolate S-homocysteine methyltransferase
 
Rhizobium sp. NGR234

Gene: NGR_c18460: 5-methyltetrahydrofolate S-homocysteine methyltransferase
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -37
score = 6.25946
sequence = ATATAAAGAACTCTTTATAT

Gene: mlr1243: 5-methyltetrahydrofolate S-homocysteine methyltransferase
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
5-methyltetrahydrofolate S-homocysteine methyltransferase
 
CRON 2.
bhmT
*
Sinorhizobium meliloti 1021

Site:
position = -53
score = 7.06142
sequence = ACATAAAGATATCTTTATAT

Gene: SMc04325: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
*
Rhizobium sp. NGR234

Site:
position = -10
score = 6.9002
sequence = ACATAAAGATATGTTTATAT

Gene: NGR_c18290: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
*
Mesorhizobium loti MAFF303099

Site:
position = -54
score = 6.13446
sequence = ACATAAAGACTTCTTTATAT

Gene: mlr1220: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
CRON 3.
sahR
*
Sinorhizobium meliloti 1021

Site:
position = -36
score = 6.77519
sequence = ACATAAACATATCTTTATGT

Gene: SMc01842: Transcriptional regulator of methionine metabolism, ArsR family
*
Rhizobium sp. NGR234

Site:
position = -37
score = 6.77519
sequence = ACATAAACATATCTTTATGT

Gene: NGR_c21320: Transcriptional regulator of methionine metabolism, ArsR family
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -36
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: RL3332: Transcriptional regulator of methionine metabolism, ArsR family
*
Rhizobium etli CFN 42

Site:
position = -33
score = 7.06142
sequence = ACATAAAGATATCTTTATAT

Gene: RHE_CH02872: Transcriptional regulator of methionine metabolism, ArsR family
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -47
score = 7.06142
sequence = ACATAAAGATATCTTTATAT

Gene: Atu2124: Transcriptional regulator of methionine metabolism, ArsR family
*
Mesorhizobium sp. BNC1

Site:
position = -36
score = 7.0252
sequence = ATATAAACATATCTTTATAT

Gene: Meso_2029: Transcriptional regulator of methionine metabolism, ArsR family
*
Mesorhizobium loti MAFF303099

Site:
position = -58
score = 6.73897
sequence = ACATAAACATATGTTTATAT

Gene: mll1589: Transcriptional regulator of methionine metabolism, ArsR family
*
Brucella melitensis 16M

Site:
position = -45
score = 7.0252
sequence = ATATAAACATATCTTTATAT

Gene: BMEI0558: Transcriptional regulator of methionine metabolism, ArsR family
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1
 
Nitrobacter winogradskyi Nb-255
*
Azorhizobium caulinodans ORS 571

Site:
position = -16
score = 7.06142
sequence = ATATAAAGATATCTTTATGT

Gene: AZC_4339: Transcriptional regulator of methionine metabolism, ArsR family
*
Xanthobacter autotrophicus Py2

Site:
position = 14
score = 7.06142
sequence = ATATAAAGATATCTTTATGT

Gene: Xaut_2830: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metF
 
Sinorhizobium meliloti 1021

Gene: SMc01843: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Rhizobium sp. NGR234

Gene: NGR_c21310: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: RL3331: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Rhizobium etli CFN 42

Gene: RHE_CH02871: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu2123: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Mesorhizobium sp. BNC1

Gene: Meso_2028: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Mesorhizobium loti MAFF303099

Gene: mll1587: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Brucella melitensis 16M

Gene: BMEI0559: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3701: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Bradyrhizobium japonicum USDA 110

Gene: bll1419: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_7060: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0284: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4340: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2831: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metH
*
Sinorhizobium meliloti 1021

Site:
position = -66
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: SMc03112: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Rhizobium sp. NGR234

Site:
position = -67
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: NGR_c30540: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -123
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: RL3362: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Rhizobium etli CFN 42

Site:
position = -18
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: RHE_CH02901: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -66
score = 6.77519
sequence = ACATAAACATATCTTTATGT

Gene: Atu2155: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Mesorhizobium sp. BNC1

Site:
position = -53
score = 6.93642
sequence = ACATAAAGATATCTTTATGT

Gene: Meso_0328: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 2
Mesorhizobium loti MAFF303099

Gene: mll6206: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)

Gene: msl6205: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Brucella melitensis 16M

Site:
position = -140
score = 6.77519
sequence = ACATAAAGATATGTTTATGT

Gene: BMEI1759: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA3702: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Bradyrhizobium japonicum USDA 110

Gene: bll1418: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_7061: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_0283: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_4341: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_2832: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
CRON 4.
ahcY
*
Sinorhizobium meliloti 1021

Site:
position = -145
score = 6.11472
sequence = ATATAAAGACCTCTTTATAT

Gene: SMc02755: Adenosylhomocysteinase (EC 3.3.1.1)
*
Rhizobium sp. NGR234

Site:
position = -97
score = 6.11472
sequence = ATATAAAGACCTCTTTATAT

Gene: NGR_c33880: Adenosylhomocysteinase (EC 3.3.1.1)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -133
score = 6.25946
sequence = ATATAAAGACTTCTTTATAT

Gene: RL0031: Adenosylhomocysteinase (EC 3.3.1.1)
*
Rhizobium etli CFN 42

Site:
position = -122
score = 6.25946
sequence = ATATAAAGACTTCTTTATAT

Gene: RHE_CH00031: Adenosylhomocysteinase (EC 3.3.1.1)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -111
score = 6.13446
sequence = ACATAAAGACTTCTTTATAT

Gene: Atu0029: Adenosylhomocysteinase (EC 3.3.1.1)
*
Mesorhizobium sp. BNC1

Site:
position = -106
score = 5.99754
sequence = GAATAAAGATTTCTTTATAT

Gene: Meso_3576: Adenosylhomocysteinase (EC 3.3.1.1)
*
Mesorhizobium loti MAFF303099

Site:
position = -143
score = 5.99754
sequence = GGATAAAGATTTCTTTATAT

Gene: mll5088: Adenosylhomocysteinase (EC 3.3.1.1)
*
Brucella melitensis 16M

Site:
position = -112
score = 6.32566
sequence = GTATAAAGATTTGTTTATAT

Gene: BMEI2029: Adenosylhomocysteinase (EC 3.3.1.1)
 
Bartonella quintana str. Toulouse

Gene: BQ00290: Adenosylhomocysteinase (EC 3.3.1.1)
 
Rhodopseudomonas palustris CGA009

Gene: RPA4015: Adenosylhomocysteinase (EC 3.3.1.1)
 
Bradyrhizobium japonicum USDA 110

Gene: bll5944: Adenosylhomocysteinase (EC 3.3.1.1)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5698: Adenosylhomocysteinase (EC 3.3.1.1)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2377: Adenosylhomocysteinase (EC 3.3.1.1)
*
Azorhizobium caulinodans ORS 571

Site:
position = -81
score = 6.63409
sequence = ATATAAACATTTCTTTATAT

Gene: AZC_4042: Adenosylhomocysteinase (EC 3.3.1.1)
*
Xanthobacter autotrophicus Py2

Site:
position = -107
score = 6.09037
sequence = ATATAAGCATTTCTTTATAT

Gene: Xaut_0186: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
metK
*
Sinorhizobium meliloti 1021

Site:
position = -94
score = 6.56162
sequence = ATATAAAGATATATTTATGT

Gene: SMc01109: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Rhizobium sp. NGR234

Site:
position = -93
score = 6.56162
sequence = ATATAAAGATATATTTATGT

Gene: NGR_c00480: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -94
score = 6.56162
sequence = ATATAAAGATATATTTATGT

Gene: RL0389: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Rhizobium etli CFN 42

Site:
position = -94
score = 6.56162
sequence = ATATAAAGATATATTTATGT

Gene: RHE_CH00370: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -91
score = 6.43662
sequence = ACATAAAGATATATTTATGT

Gene: Atu0362: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Mesorhizobium sp. BNC1

Gene: Meso_3924: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Mesorhizobium loti MAFF303099

Gene: mlr5545: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Brucella melitensis 16M

Gene: BMEI1970: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Bartonella quintana str. Toulouse

Gene: BQ02080: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Rhodopseudomonas palustris CGA009

Gene: RPA4016: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Bradyrhizobium japonicum USDA 110

Gene: bll5945: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5699: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2378: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_0014: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1816: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD