Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 2 1
Pseudomonas entomophila L48 2 1
Pseudomonas putida KT2440 2 1
Pseudomonas syringae pv. tomato str. DC3000 2 1
Pseudomonas fluorescens Pf-5 2 1
Pseudomonas mendocina ymp 2 1
Pseudomonas stutzeri A1501 2 1
Azotobacter vinelandii AvOP 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sahR
*
Pseudomonas aeruginosa PAO1

Site:
position = -62
score = 6.94857
sequence = ATATCAAAAATTTTTGATAC

Gene: PA0547: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas entomophila L48

Site:
position = -62
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: PSEEN5025: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas putida KT2440

Site:
position = -62
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: PP4966: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas syringae pv. tomato str. DC3000

Site:
position = -62
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: PSPTO0384: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas fluorescens Pf-5

Site:
position = -35
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: PFL_5787: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas mendocina ymp

Site:
position = -62
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: Pmen_0455: Transcriptional regulator of methionine metabolism, ArsR family
*
Pseudomonas stutzeri A1501

Site:
position = -63
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: PST_3925: Transcriptional regulator of methionine metabolism, ArsR family
*
Azotobacter vinelandii AvOP

Site:
position = -62
score = 6.86165
sequence = ATATCAAAACTTTTTGATAC

Gene: Avin_05540: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metK
 
Pseudomonas aeruginosa PAO1

Gene: PA0546: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas entomophila L48

Gene: PSEEN5026: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas putida KT2440

Gene: PP4967: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO0383: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas fluorescens Pf-5

Gene: PFL_5788: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas mendocina ymp

Gene: Pmen_0454: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Pseudomonas stutzeri A1501

Gene: PST_3926: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Azotobacter vinelandii AvOP

Gene: Avin_05530: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD