Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 4 1
Marinobacter aqueolei 4 2
Marinobacter sp. ELB17 4 2
Oceanobacter sp. RED65 4 1
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40 5 2
Teredinibacter turnerae T7901 5 2
Cellvibrio japonicus Ueda107 5 2
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297 2 2
Alcanivorax borkumensis SK2 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metH
 
Hahella chejuensis KCTC 2396

Gene: HCH_02542: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Marinobacter aqueolei

Gene: Maqu_1526: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Marinobacter sp. ELB17

Gene: MELB17_13841: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 2
Oceanobacter sp. RED65

Gene: RED65_09029: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)

Gene: RED65_09024: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Oceanospirillum sp. MED92

Gene: MED92_04362: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_2169: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Saccharophagus degradans 2-40

Site:
position = -42
score = 6.07726
sequence = AAATCGAAATATTTTGATAT

Gene: Sde_2010: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Teredinibacter turnerae T7901

Site:
position = -52
score = 6.47156
sequence = ATATCAAAGTATTTTGATAT

Gene: TERTU_2126: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Cellvibrio japonicus Ueda107

Site:
position = -63
score = 6.44463
sequence = ATATCAATTTTTTTTGATAT

Gene: CJA_2542: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_1889: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
*
Reinekea sp. MED297

Site:
position = -87
score = 7.01
sequence = ATATCAAAATATTTTGATAT

Gene: MED297_01810: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
Alcanivorax borkumensis SK2

Gene: ABO_1324: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
 
CRON 2.
sahR
*
Hahella chejuensis KCTC 2396

Site:
position = -41
score = 6.74322
sequence = ATATCAAATTTTTTTGATAT

Gene: HCH_01534: Transcriptional regulator of methionine metabolism, ArsR family
*
Marinobacter aqueolei

Site:
position = -62
score = 7.12858
sequence = ATATCAAAAAATTTTGATAT

Gene: Maqu_3041: Transcriptional regulator of methionine metabolism, ArsR family
*
Marinobacter sp. ELB17

Site:
position = -62
score = 6.59014
sequence = ATATCAAAAAACTTTGATAT

Gene: MELB17_04857: Transcriptional regulator of methionine metabolism, ArsR family
*
Oceanobacter sp. RED65

Site:
position = -61
score = 7.01
sequence = ATATCAAAATATTTTGATAT

Gene: RED65_14437: Transcriptional regulator of methionine metabolism, ArsR family
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -49
score = 6.82999
sequence = ATATCAATATTTTTTGATAT

Gene: Sde_0471: Transcriptional regulator of methionine metabolism, ArsR family
*
Teredinibacter turnerae T7901

Site:
position = -49
score = 7.16024
sequence = ATATCAAAACTTTTTGATAT

Gene: TERTU_3975: Transcriptional regulator of methionine metabolism, ArsR family
*
Cellvibrio japonicus Ueda107

Site:
position = -23
score = 7.12858
sequence = ATATCAAAAAATTTTGATAT

Gene: CJA_0208: Transcriptional regulator of methionine metabolism, ArsR family
 
Chromohalobacter salexigens DSM 3043
*
Reinekea sp. MED297

Site:
position = -61
score = 7.01
sequence = ATATCAAAATATTTTGATAT

Gene: MED297_05504: Transcriptional regulator of methionine metabolism, ArsR family
*
Alcanivorax borkumensis SK2

Site:
position = -49
score = 5.94068
sequence = ATATCAATTTATTTTGATTT

Gene: ABO_2616: Transcriptional regulator of methionine metabolism, ArsR family
Transcriptional regulator of methionine metabolism, ArsR family
metK
 
Hahella chejuensis KCTC 2396

Gene: HCH_01533: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Marinobacter aqueolei

Site:
position = -125
score = 6.8067
sequence = ATATCAAAAACTTTTGATAT

Gene: Maqu_3042: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Marinobacter sp. ELB17

Site:
position = -126
score = 6.59014
sequence = ATATCAAAAAAGTTTGATAT

Gene: MELB17_04852: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Oceanobacter sp. RED65

Gene: RED65_14442: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Oceanospirillum sp. MED92

Gene: MED92_07221: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_4320: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Saccharophagus degradans 2-40

Gene: Sde_0470: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Teredinibacter turnerae T7901

Gene: TERTU_3976: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0207: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0385: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Reinekea sp. MED297

Gene: MED297_05514: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Alcanivorax borkumensis SK2

Gene: ABO_2617: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
ahcY
 
Hahella chejuensis KCTC 2396

Gene: HCH_01532: Adenosylhomocysteinase (EC 3.3.1.1)
 
Marinobacter aqueolei

Gene: Maqu_3043: Adenosylhomocysteinase (EC 3.3.1.1)
 
Marinobacter sp. ELB17

Gene: MELB17_04847: Adenosylhomocysteinase (EC 3.3.1.1)
 
Oceanobacter sp. RED65

Gene: RED65_14447: Adenosylhomocysteinase (EC 3.3.1.1)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_0469: Adenosylhomocysteinase (EC 3.3.1.1)
 
Teredinibacter turnerae T7901

Gene: TERTU_3977: Adenosylhomocysteinase (EC 3.3.1.1)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0206: Adenosylhomocysteinase (EC 3.3.1.1)
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_05519: Adenosylhomocysteinase (EC 3.3.1.1)
 
Alcanivorax borkumensis SK2

Gene: ABO_2618: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
metF
 
Hahella chejuensis KCTC 2396

Gene: HCH_01531: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Marinobacter aqueolei

Gene: Maqu_3044: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Marinobacter sp. ELB17

Gene: MELB17_04842: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Oceanobacter sp. RED65

Gene: RED65_14452: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_0468: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Teredinibacter turnerae T7901

Gene: TERTU_3978: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Cellvibrio japonicus Ueda107

Gene: CJA_0205: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0396: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Reinekea sp. MED297

Gene: MED297_05524: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Alcanivorax borkumensis SK2

Gene: ABO_2619: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD