Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021
Rhizobium sp. NGR234
Rhizobium leguminosarum bv. viciae 3841
Rhizobium etli CFN 42 3 2
Agrobacterium tumefaciens str. C58 (Cereon)
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1 3 2
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium etli CFN 42

Site:
position = -68
score = 5.69772
sequence = TTAGTGAGAAATGTCAACTAA

Site:
position = -46
score = 5.87767
sequence = TTAGTTGAAGATTTACACTAA

Gene: RHE_PF00027: Nudix-related transcriptional regulator NrtR
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -83
score = 5.25584
sequence = TAAGTGTGTCACGACAACTAA

Site:
position = -61
score = 5.92953
sequence = TAAGTTGGACAGTACAACTAA

Gene: BBta_5113: Nudix-related transcriptional regulator NrtR
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
Nudix-related transcriptional regulator NrtR
 
CRON 2.
nrtX
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
*
Rhizobium etli CFN 42

Site:
position = -81
score = 5.69772
sequence = TTAGTTGACATTTCTCACTAA

Site:
position = -103
score = 5.87767
sequence = TTAGTGTAAATCTTCAACTAA

Gene: RHE_PF00026: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
*
Bradyrhizobium sp. BTAi1

Site:
position = -68
score = 5.92953
sequence = TTAGTTGTACTGTCCAACTTA

Site:
position = -46
score = 5.25584
sequence = TTAGTTGTCGTGACACACTTA

Gene: BBta_5114: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
 
Sinorhizobium meliloti 1021
 
Rhizobium sp. NGR234
 
Rhizobium leguminosarum bv. viciae 3841
 
Rhizobium etli CFN 42

Gene: RHE_PF00025: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Agrobacterium tumefaciens str. C58 (Cereon)
 
Mesorhizobium sp. BNC1
 
Mesorhizobium loti MAFF303099
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009
 
Bradyrhizobium japonicum USDA 110
 
Bradyrhizobium sp. BTAi1

Gene: BBta_5115: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Nitrobacter winogradskyi Nb-255
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD