Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1 4 1
Acidovorax sp. JS42
Comamonas testosteroni KF-1
Delftia acidovorans SPH-1 3 2
Polaromonas naphthalenivorans CJ2 5 2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110 5 2
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_4021: Nudix-like transcriptional regulator NrtR
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4597: Nudix-like transcriptional regulator NrtR
*
Delftia acidovorans SPH-1

Site:
position = -74
score = 5.67001
sequence = TAAGTTGTTCTGTACAACTCG

Site:
position = -51
score = 5.98898
sequence = TGGGTTGCATAGTGCAACTTA

Gene: Daci_5757: Nudix-like transcriptional regulator NrtR
*
Polaromonas naphthalenivorans CJ2

Site:
position = -104
score = 5.90084
sequence = TAGGTTGTACTGAACAACCTT

Site:
position = -79
score = 5.77867
sequence = TGGGTTGCATAATACAACCTT

Gene: Pnap_3721: Nudix-like transcriptional regulator NrtR
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
*
Variovorax paradoxus S110

Site:
position = -41
score = 6.04416
sequence = AGAGTTGTTCTGTACAACCCA

Gene: Vapar_6281: Nudix-like transcriptional regulator NrtR
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Nudix-like transcriptional regulator NrtR
 
CRON 2.
pncA
*
Acidovorax avenae subsp. citrulli AAC00-1

Site:
position = -63
score = 5.08347
sequence = TTAGTTGCACAAATAAACTAA

Gene: Aave_0977: Nicotinamidase (EC 3.5.1.19)
 
Acidovorax sp. JS42

Gene: Ajs_0702: Nicotinamidase (EC 3.5.1.19)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4596: Nicotinamidase (EC 3.5.1.19)
 
Delftia acidovorans SPH-1

Gene: Daci_5605: Nicotinamidase (EC 3.5.1.19)
*
Polaromonas naphthalenivorans CJ2

Site:
position = -48
score = 6.20948
sequence = AAGGTTGTTCAGTACAACCTA

Site:
position = -73
score = 5.74469
sequence = AAGGTTGTATTATGCAACCCA

Gene: Pnap_3720: Nicotinamidase (EC 3.5.1.19)
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_0828: Nicotinamidase (EC 3.5.1.19)
*2
Variovorax paradoxus S110

Gene: Vapar_0187: Nicotinamidase (EC 3.5.1.19)

Site:
position = -61
score = 6.04671
sequence = ATGGTTGTACAGTGCAACCAA

Site:
position = -38
score = 6.17231
sequence = AGAGTTGCACAGTACAACTAA

Gene: Vapar_6282: Nicotinamidase (EC 3.5.1.19)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_0861: Nicotinamidase (EC 3.5.1.19)
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Nicotinamidase (EC 3.5.1.19)
pncB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0976: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4581: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Delftia acidovorans SPH-1

Gene: Daci_5606: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3719: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_6283: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadE
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0975: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4580: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
Delftia acidovorans SPH-1

Gene: Daci_5607: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3718: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_6284: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
nadM
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_0974: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Acidovorax sp. JS42

Gene: Ajs_0701: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_4579: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Delftia acidovorans SPH-1

Gene: Daci_5608: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_3717: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110

Gene: Vapar_6285: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
nrtX
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
*
Delftia acidovorans SPH-1

Site:
position = -58
score = 5.78196
sequence = TAAGTTGCACTATGCAACCCA

Site:
position = -35
score = 5.95447
sequence = CGAGTTGTACAGAACAACTTA

Gene: Daci_5758: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1
 
Delftia acidovorans SPH-1

Gene: Daci_5759: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD