Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 3 1
Acinetobacter baumannii AB0057 3 1
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
prs
*
Acinetobacter sp. ADP1

Site:
position = -60
score = 6.19499
sequence = AAATTGTCTTTATGCCACTAT

Site:
position = -35
score = 5.30124
sequence = TTAATGGCTTTATGCCACTAT

Gene: ACIAD0964: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
*
Acinetobacter baumannii AB0057

Site:
position = -58
score = 5.84187
sequence = ATAGTGGCTTTGTGCCACTAT

Gene: AB57_2115: Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Ribose-phosphate pyrophosphokinase (EC 2.7.6.1)
nadV
 
Acinetobacter sp. ADP1

Gene: ACIAD0963: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Acinetobacter baumannii AB0057

Gene: AB57_2114: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Psychrobacter arcticum 273-4

Gene: Psyc_1914: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1852: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
nrtR
 
Acinetobacter sp. ADP1

Gene: ACIAD0962: Nudix-related transcriptional regulator NrtR
 
Acinetobacter baumannii AB0057

Gene: AB57_2113: Nudix-related transcriptional regulator NrtR
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1
Nudix-related transcriptional regulator NrtR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD