Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Pseudomonadaceae

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudomonas aeruginosa PAO1 5 2
Pseudomonas entomophila L48 3 2
Pseudomonas putida KT2440
Pseudomonas syringae pv. tomato str. DC3000
Pseudomonas fluorescens Pf-5 6 2
Pseudomonas mendocina ymp 4 2
Pseudomonas stutzeri A1501
Azotobacter vinelandii AvOP
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadD
*
Pseudomonas aeruginosa PAO1

Site:
position = -69
score = 5.42041
sequence = ATAATTCATCACGTGAAATAA

Gene: PA4917: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -35
score = 5.41151
sequence = AAGGTACACGTCATGTACCAA

Site:
position = -156
score = 5.46795
sequence = AAAGTATATGTCATGTACTTT

Gene: PFL_2465: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
nrtR
 
Pseudomonas aeruginosa PAO1

Gene: PA4916: Nudix-related transcriptional regulator NrtR
*
Pseudomonas entomophila L48

Site:
position = -113
score = 5.3333
sequence = ATAATTCACCTGGTGCATTAA

Gene: PSEEN2060: Nudix-related transcriptional regulator NrtR
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2464: Nudix-related transcriptional regulator NrtR
*
Pseudomonas mendocina ymp

Site:
position = -109
score = 5.25428
sequence = ATATTTCATCTGATGAAATAT

Gene: Pmen_1413: Nudix-related transcriptional regulator NrtR
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nudix-related transcriptional regulator NrtR
PFL_2463
 
Pseudomonas aeruginosa PAO1
 
Pseudomonas entomophila L48
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
 
Pseudomonas fluorescens Pf-5

Gene: PFL_2463: ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Pseudomonas mendocina ymp
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
CRON 2.
pncA
*
Pseudomonas aeruginosa PAO1

Site:
position = -61
score = 5.42041
sequence = TTATTTCACGTGATGAATTAT

Gene: PA4918: Nicotinamidase (EC 3.5.1.19)
*
Pseudomonas entomophila L48

Site:
position = -51
score = 5.3333
sequence = TTAATGCACCAGGTGAATTAT

Gene: PSEEN2059: Nicotinamidase (EC 3.5.1.19)
 
Pseudomonas putida KT2440
 
Pseudomonas syringae pv. tomato str. DC3000
*
Pseudomonas fluorescens Pf-5

Site:
position = -48
score = 5.46795
sequence = AAAGTACATGACATATACTTT

Site:
position = -169
score = 5.41151
sequence = TTGGTACATGACGTGTACCTT

Gene: PFL_2466: Nicotinamidase (EC 3.5.1.19)
*
Pseudomonas mendocina ymp

Site:
position = -52
score = 5.25428
sequence = ATATTTCATCAGATGAAATAT

Gene: Pmen_1412: Nicotinamidase (EC 3.5.1.19)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nicotinamidase (EC 3.5.1.19)
pncB
 
Pseudomonas aeruginosa PAO1

Gene: PA4919: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 2
Pseudomonas entomophila L48

Gene: PSEEN4919: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Gene: PSEEN2058: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pseudomonas putida KT2440

Gene: PP4868: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO4921: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 2
Pseudomonas fluorescens Pf-5

Gene: PFL_2467: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Gene: PFL_0594: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pseudomonas mendocina ymp

Gene: Pmen_1411: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Pseudomonas stutzeri A1501
 
Azotobacter vinelandii AvOP
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadE
 
Pseudomonas aeruginosa PAO1

Gene: PA4920: NAD synthetase (EC 6.3.1.5)
 
Pseudomonas entomophila L48

Gene: PSEEN4920: NAD synthetase (EC 6.3.1.5)
 
Pseudomonas putida KT2440

Gene: PP4869: NAD synthetase (EC 6.3.1.5)
 
Pseudomonas syringae pv. tomato str. DC3000

Gene: PSPTO4922: NAD synthetase (EC 6.3.1.5)
 2
Pseudomonas fluorescens Pf-5

Gene: PFL_2468: NAD synthetase (EC 6.3.1.5)

Gene: PFL_0593: NAD synthetase (EC 6.3.1.5)
 
Pseudomonas mendocina ymp

Gene: Pmen_1410: NAD synthetase (EC 6.3.1.5)
 
Pseudomonas stutzeri A1501

Gene: PST_1831: NAD synthetase (EC 6.3.1.5)
 
Azotobacter vinelandii AvOP
NAD synthetase (EC 6.3.1.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD