Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396 7 4
Marinobacter aqueolei
Marinobacter sp. ELB17 5 2
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297
Alcanivorax borkumensis SK2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
*
Hahella chejuensis KCTC 2396

Site:
position = -41
score = 5.98504
sequence = TTAGTGGCCTAATGCCACTAA

Gene: HCH_06996: Nudix-related transcriptional regulator NrtR
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -73
score = 4.71508
sequence = TGTGTCAATTGATTTGACAGA

Site:
position = -116
score = 4.51655
sequence = TTAGTCAATTCATTTGACGGT

Gene: MELB17_12281: Nudix-related transcriptional regulator NrtR
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nudix-related transcriptional regulator NrtR
 
CRON 2.
nrtX
*
Hahella chejuensis KCTC 2396

Site:
position = -46
score = 5.61695
sequence = TTGGTGGCTTTGAGCCACTAT

Gene: HCH_04328: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
 
Hahella chejuensis KCTC 2396

Gene: HCH_04327: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
CRON 3.
nadM
*
Hahella chejuensis KCTC 2396

Site:
position = -126
score = 6.04466
sequence = TTAGTGTCATTATGCCACTAT

Gene: HCH_06993: Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinamide-nucleotide adenylyltransferase, NadM family (EC 2.7.7.1) / ADP-ribose pyrophosphatase (EC 3.6.1.13)
nadV
 
Hahella chejuensis KCTC 2396

Gene: HCH_06992: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
CRON 4.
pnuC
*
Hahella chejuensis KCTC 2396

Site:
position = -103
score = 6.17106
sequence = TTAGTGGCATTAGGCCACTAA

Gene: HCH_06995: Ribosyl nicotinamide transporter, PnuC-like
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Ribosyl nicotinamide transporter, PnuC-like
nadR
 
Hahella chejuensis KCTC 2396

Gene: HCH_06994: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
 
CRON 5.
pncB
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
*
Marinobacter sp. ELB17

Site:
position = -75
score = 4.71508
sequence = TCTGTCAAATCAATTGACACA

Gene: MELB17_12286: Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinamide phosphoribosyltransferase (EC 2.4.2.12)
nadE
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_12291: NAD synthetase (EC 6.3.1.5)
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92

Gene: MED92_18213: NAD synthetase (EC 6.3.1.5)
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_04869: NAD synthetase (EC 6.3.1.5)
 
Alcanivorax borkumensis SK2
NAD synthetase (EC 6.3.1.5)
pncA
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_12296: Nicotinamidase (EC 3.5.1.19)
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_2870: Nicotinamidase (EC 3.5.1.19)
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinamidase (EC 3.5.1.19)
nadD
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17

Gene: MELB17_12301: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD