Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37
Psychromonas sp. CNPT3
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966 3 2
Aeromonas salmonicida subsp. salmonicida A449 3 2
Tolumonas auensis DSM 9187 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pncB
 
Psychromonas ingrahamii 37

Gene: Ping_1730: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_4212: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0113: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Tolumonas auensis DSM 9187

Site:
position = -109
score = 5.36944
sequence = TTGGTATCTTAAAGGAACCAA

Gene: Tola_0586: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
nadE
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187

Gene: Tola_0587: NAD+ synthetase
NAD+ synthetase
pncA
 
Psychromonas ingrahamii 37

Gene: Ping_1729: Nicotinamidase (EC 3.5.1.19)
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -44
score = 5.89571
sequence = TTGGTAGATAATATCACACGA

Gene: AHA_4211: Nicotinamidase (EC 3.5.1.19)
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -43
score = 5.89571
sequence = TTGGTAGATAATATCACACGA

Gene: ASA_0114: Nicotinamidase (EC 3.5.1.19)
 
Tolumonas auensis DSM 9187
Nicotinamidase (EC 3.5.1.19)
 
CRON 2.
nadD
 
Psychromonas ingrahamii 37

Gene: Ping_1188: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Psychromonas sp. CNPT3

Gene: PCNPT3_04921: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Moritella sp. PE36

Gene: PE36_22130: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3251: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_1065: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
*
Tolumonas auensis DSM 9187

Site:
position = -96
score = 5.36944
sequence = TTGGTTCCTTTAAGATACCAA

Gene: Tola_0585: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
nrtR
 
Psychromonas ingrahamii 37
 
Psychromonas sp. CNPT3
 
Moritella sp. PE36
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Site:
position = -52
score = 5.89571
sequence = TCGTGTGATATTATCTACCAA

Gene: AHA_4210: Nudix-related transcriptional regulator NrtR
*
Aeromonas salmonicida subsp. salmonicida A449

Site:
position = -52
score = 5.89571
sequence = TCGTGTGATATTATCTACCAA

Gene: ASA_0115: Nudix-related transcriptional regulator NrtR
 
Tolumonas auensis DSM 9187

Gene: Tola_0584: Nudix-related transcriptional regulator NrtR
Nudix-related transcriptional regulator NrtR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD