Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio cholerae O1 biovar eltor str. N16961 2 2
Vibrio vulnificus CMCP6 3 2
Vibrio harveyi ATCC BAA-1116 3 2
Vibrio parahaemolyticus RIMD 2210633 3 2
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio fischeri ES114
Vibrio salmonicida LFI1238
Vibrio angustum S14
Photobacterium profundum SS9
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pncB
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -103
score = 6.43655
sequence = TTTGTCACAAAAGTTGACAAA

Site:
position = -50
score = 5.49614
sequence = TTAGCAACAAAATGTTACTAA

Gene: VCA0098: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Vibrio vulnificus CMCP6

Site:
position = -96
score = 6.09957
sequence = TTAGTAACAAAAATTGACAAA

Gene: VV1_2372: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -196
score = 6.20385
sequence = TTAGTAACAAAAGTTGACAAA

Gene: VIBHAR_06575: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -106
score = 6.20385
sequence = TTAGTAACAAAAGTTGACAAA

Gene: VPA0309: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Vibrio shilonii AK1

Gene: VSAK1_23614: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 2
Vibrio angustum S14

Gene: VAS14_02923: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Gene: VAS14_02928: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
Photobacterium profundum SS9

Gene: PBPRA1763: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
 
CRON 2.
nrtR
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -316
score = 6.43655
sequence = TTTGTCAACTTTTGTGACAAA

Gene: VCA0097: Nudix-related transcriptional regulator NrtR
*
Vibrio vulnificus CMCP6

Site:
position = -203
score = 6.09957
sequence = TTTGTCAATTTTTGTTACTAA

Gene: VV1_2373: Nudix-related transcriptional regulator NrtR
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -215
score = 6.20385
sequence = TTTGTCAACTTTTGTTACTAA

Gene: VIBHAR_06576: Nudix-related transcriptional regulator NrtR
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -214
score = 6.20385
sequence = TTTGTCAACTTTTGTTACTAA

Gene: VPA0308: Nudix-related transcriptional regulator NrtR
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14
 
Photobacterium profundum SS9
Nudix-related transcriptional regulator NrtR
pncA
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0712: Nicotinamidase (EC 3.5.1.19)
 
Vibrio vulnificus CMCP6

Gene: VV1_2374: Nicotinamidase (EC 3.5.1.19)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_06577: Nicotinamidase (EC 3.5.1.19)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VPA0307: Nicotinamidase (EC 3.5.1.19)
 
Vibrio shilonii AK1

Gene: VSAK1_23619: Nicotinamidase (EC 3.5.1.19)
 
Vibrio splendidus LGP32
 
Vibrio fischeri ES114
 
Vibrio salmonicida LFI1238
 
Vibrio angustum S14

Gene: VAS14_02186: Nicotinamidase (EC 3.5.1.19)
 
Photobacterium profundum SS9

Gene: PBPRA3449: Nicotinamidase (EC 3.5.1.19)
Nicotinamidase (EC 3.5.1.19)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD