Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NrtR - Enterobacteriales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Escherichia coli str. K-12 substr. MG1655
Salmonella typhimurium LT2
Citrobacter koseri ATCC BAA-895
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Yersinia pestis KIM
Serratia proteamaculans 568
Erwinia carotovora subsp. atroseptica SCRI1043
Edwardsiella tarda EIB202
Proteus mirabilis HI4320 3 2
Photorhabdus luminescens subsp. laumondii TTO1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtX
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -33
score = 5.05885
sequence = TTAATGTCATAAGGACACTAA

Site:
position = -58
score = 6.59727
sequence = ATAGTGTCCATAAGACAATAT

Site:
position = -93
score = 5.63206
sequence = ATTTTGTCATAAAGACACTAA

Gene: PMI2396: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Photorhabdus luminescens subsp. laumondii TTO1
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
 
Proteus mirabilis HI4320

Gene: PMI2397: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Photorhabdus luminescens subsp. laumondii TTO1
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
CRON 2.
nrtR
 
Escherichia coli str. K-12 substr. MG1655
 
Salmonella typhimurium LT2
 
Citrobacter koseri ATCC BAA-895
 
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
 
Enterobacter sp. 638
 
Erwinia amylovora ATCC 49946
 
Yersinia pestis KIM
 
Serratia proteamaculans 568
 
Erwinia carotovora subsp. atroseptica SCRI1043
 
Edwardsiella tarda EIB202
*
Proteus mirabilis HI4320

Site:
position = -115
score = 6.59727
sequence = ATATTGTCTTATGGACACTAT

Site:
position = -80
score = 5.63206
sequence = TTAGTGTCTTTATGACAAAAT

Site:
position = -140
score = 5.05885
sequence = TTAGTGTCCTTATGACATTAA

Gene: PMI2395: NUDIX-family transcriptional regulator NrtR
 
Photorhabdus luminescens subsp. laumondii TTO1
NUDIX-family transcriptional regulator NrtR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD