Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15 7 3
Caulobacter segnis ATCC 21756 6 3
Caulobacter sp. K31 7 3
Phenylobacterium zucineum HLK1 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
proA
*
Caulobacter crescentus CB15

Site:
position = -73
score = 5.03019
sequence = TAAGCCTCAACCTGAGCATAA

Gene: CC3430: Gamma-glutamyl phosphate reductase (EC 1.2.1.41)
*
Caulobacter segnis ATCC 21756

Site:
position = -41
score = 5.03019
sequence = TAAGCCTCAACCTGAGCATAA

Gene: Cseg_0251: Gamma-glutamyl phosphate reductase (EC 1.2.1.41)
*
Caulobacter sp. K31

Site:
position = -39
score = 5.41317
sequence = TAAGGCTCACTCTGAGCATAT

Gene: Caul_4717: Gamma-glutamyl phosphate reductase (EC 1.2.1.41)
*
Phenylobacterium zucineum HLK1

Site:
position = -28
score = 4.70212
sequence = AAGTGCTCACCTTGAGCAAAT

Gene: PHZ_c0252: Gamma-glutamyl phosphate reductase (EC 1.2.1.41)
Gamma-glutamyl phosphate reductase (EC 1.2.1.41)
nadD
 
Caulobacter crescentus CB15

Gene: CC3431: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Caulobacter segnis ATCC 21756

Gene: Cseg_0250: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Caulobacter sp. K31

Gene: Caul_4718: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c0251: Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
Nicotinate-nucleotide adenylyltransferase (EC 2.7.7.18) ## bacterial NadD family
 
CRON 2.
nadE
*
Caulobacter crescentus CB15

Site:
position = -39
score = 6.30455
sequence = TTATGCTCAGTTTCAGCATAA

Gene: CC3619: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
*
Caulobacter segnis ATCC 21756

Site:
position = -33
score = 6.30455
sequence = TTATGCTCACTTTCAGCATAA

Gene: Cseg_4105: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
*
Caulobacter sp. K31

Site:
position = -40
score = 6.15542
sequence = TTATGCTCATTTTTAGCATAA

Gene: Caul_4914: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
*
Phenylobacterium zucineum HLK1

Site:
position = -46
score = 5.98634
sequence = ATATGCTCAAAGTGAGCATTT

Gene: PHZ_c1931: NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
NAD synthetase (EC 6.3.1.5) / Glutamine amidotransferase chain of NAD synthetase
 
CRON 3.
nadA
*
Caulobacter crescentus CB15

Site:
position = -85
score = 6.30455
sequence = TTATGCTCACTTTCAGCATAA

Site:
position = -2
score = 6.14545
sequence = AAATGCTCACTTTGAGCATAA

Gene: CC2912: Quinolinate synthetase (EC 4.1.99.-)
*
Caulobacter segnis ATCC 21756

Site:
position = -32
score = 6.14545
sequence = AAATGCTCACTTTGAGCATAA

Site:
position = -103
score = 6.30455
sequence = TTATGCTCAGTTTCAGCATAA

Gene: Cseg_3422: Quinolinate synthetase (EC 4.1.99.-)
*
Caulobacter sp. K31

Site:
position = -117
score = 6.00198
sequence = TTTTGCTCAATTTCAGCATAA

Site:
position = -32
score = 6.14545
sequence = AAATGCTCAGTTTGAGCATAA

Gene: Caul_4308: Quinolinate synthetase (EC 4.1.99.-)
*
Phenylobacterium zucineum HLK1

Site:
position = -98
score = 5.42929
sequence = TTTTGCTCCGATTGAGCAAAA

Site:
position = -33
score = 6.26102
sequence = TAATGCTCACTATGAGCATAA

Gene: PHZ_c2607: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Caulobacter crescentus CB15

Gene: CC2913: L-aspartate oxidase
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3423: L-aspartate oxidase
 
Caulobacter sp. K31

Gene: Caul_4309: L-aspartate oxidase
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2608: L-aspartate oxidase
L-aspartate oxidase
CC2914
 
Caulobacter crescentus CB15

Gene: CC2914: hypothetical protein
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_4310: hypothetical protein
 
Phenylobacterium zucineum HLK1
hypothetical protein
nadC
 
Caulobacter crescentus CB15

Gene: CC2915: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Caulobacter segnis ATCC 21756

Gene: Cseg_3424: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Caulobacter sp. K31

Gene: Caul_4311: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c2609: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD