Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Rhodospirillales

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 10 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodospirillum rubrum ATCC 11170 3 1
Magnetospirillum magnetotacticum MS-1 2 1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510 3 1
Rhodospirillum centenum SW 3 1
Gluconacetobacter diazotrophicus PAl 5 3 1
Acetobacter pasteurianus IFO 3283-01 2 1
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadA
*
Rhodospirillum rubrum ATCC 11170

Site:
position = -78
score = 6.09447
sequence = ATTTGCTCACTTTGAGCATAA

Gene: Rru_A1434: Quinolinate synthetase (EC 4.1.99.-)
*4
Magnetospirillum magnetotacticum MS-1

Gene: Magn03006927: Quinolinate synthetase (EC 4.1.99.-)

Gene: Magn03008845: Quinolinate synthetase (EC 4.1.99.-)

Gene: Magn03003325: Quinolinate synthetase (EC 4.1.99.-)

Site:
position = -91
score = 6.02305
sequence = TTATGCTCAGTCTCAGCATAT

Site:
position = -32
score = 5.8176
sequence = CAATGCTCATTTTGAGCATAA

Gene: Magn03003324: Quinolinate synthetase (EC 4.1.99.-)
 
Magnetospirillum magneticum AMB-1

Gene: amb3886: Quinolinate synthetase (EC 4.1.99.-)
*
Azospirillum sp. B510

Site:
position = -21
score = 5.06597
sequence = ATATACTCTTATAGAGCACAT

Gene: AZL_d02880: Quinolinate synthetase (EC 4.1.99.-)
*
Rhodospirillum centenum SW

Site:
position = -107
score = 5.11067
sequence = TTTTACTCTGCGCGAGCATAA

Site:
position = -80
score = 5.9155
sequence = AAATGCTCAAATCGAGCATAA

Gene: RC1_2989: Quinolinate synthetase (EC 4.1.99.-)
*
Gluconacetobacter diazotrophicus PAl 5

Site:
position = -42
score = 6.43104
sequence = TTATACTCACAGTGAGTATAA

Gene: Gdia_1429: Quinolinate synthetase (EC 4.1.99.-)
*
Acetobacter pasteurianus IFO 3283-01

Site:
position = -42
score = 6.42016
sequence = ATATACTCAAATTGAGCATAT

Gene: APA01_20500: Quinolinate synthetase (EC 4.1.99.-)
 
Gluconobacter oxydans 621H
*
Granulibacter bethesdensis CGDNIH1

Site:
position = -85
score = 6.03107
sequence = TTATGCTCATTTACAGCATAA

Site:
position = -33
score = 6.24595
sequence = ATATGCTCAAAAAGAGCATAA

Gene: GbCGDNIH1_0640: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1433: L-aspartate oxidase (EC 1.4.3.16)
 4
Magnetospirillum magnetotacticum MS-1

Gene: Magn03006929: L-aspartate oxidase (EC 1.4.3.16)

Gene: Magn03003508: L-aspartate oxidase (EC 1.4.3.16)

Gene: Magn03009375: L-aspartate oxidase (EC 1.4.3.16)

Gene: Magn03003772: L-aspartate oxidase (EC 1.4.3.16)
 
Magnetospirillum magneticum AMB-1

Gene: amb3884: L-aspartate oxidase (EC 1.4.3.16)
 
Azospirillum sp. B510

Gene: AZL_d02890: L-aspartate oxidase (EC 1.4.3.16)
 
Rhodospirillum centenum SW

Gene: RC1_2990: L-aspartate oxidase (EC 1.4.3.16)
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1428: L-aspartate oxidase (EC 1.4.3.16)
 
Acetobacter pasteurianus IFO 3283-01
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0641: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Rhodospirillum rubrum ATCC 11170

Gene: Rru_A1432: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 2
Magnetospirillum magnetotacticum MS-1

Gene: Magn03006928: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Gene: Magn03003771: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Magnetospirillum magneticum AMB-1

Gene: amb3885: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Azospirillum sp. B510

Gene: AZL_d02900: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Rhodospirillum centenum SW

Gene: RC1_2991: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Gluconacetobacter diazotrophicus PAl 5

Gene: Gdia_1427: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Acetobacter pasteurianus IFO 3283-01

Gene: APA01_20490: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Gluconobacter oxydans 621H
 
Granulibacter bethesdensis CGDNIH1

Gene: GbCGDNIH1_0642: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD