Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444 5 2
Oceanicaulis alexandrii HTCC2633 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadA
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4432: Quinolinate synthetase (EC 4.1.99.-)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17161: Quinolinate synthetase (EC 4.1.99.-)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_11021: Quinolinate synthetase (EC 4.1.99.-)
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_18062: Quinolinate synthetase (EC 4.1.99.-)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_2250: Quinolinate synthetase (EC 4.1.99.-)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3243: Quinolinate synthetase (EC 4.1.99.-)
 
Roseobacter sp. MED193

Gene: MED193_17559: Quinolinate synthetase (EC 4.1.99.-)
*
Hyphomonas neptunium ATCC 15444

Site:
position = -182
score = 6.38604
sequence = TTATACTCAAATCGAGCATAA

Gene: HNE_0692: Quinolinate synthetase (EC 4.1.99.-)
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -119
score = 5.11693
sequence = TTAGGCTCATGTAGAGCAAAA

Site:
position = -54
score = 5.87196
sequence = AAATGCTCATATCGAGCATAA

Gene: OA2633_14311: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
HNE_0691
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0691: hypothetical protein
 
Oceanicaulis alexandrii HTCC2633
hypothetical protein
nadB
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4431: L-aspartate oxidase (EC 1.4.3.16)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17166: L-aspartate oxidase (EC 1.4.3.16)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_11026: L-aspartate oxidase (EC 1.4.3.16)
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_18057: L-aspartate oxidase (EC 1.4.3.16)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_2249: L-aspartate oxidase (EC 1.4.3.16)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3244: L-aspartate oxidase (EC 1.4.3.16)
 
Roseobacter sp. MED193

Gene: MED193_17554: L-aspartate oxidase (EC 1.4.3.16)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0690: L-aspartate oxidase (EC 1.4.3.16)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14306: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222

Gene: Pden_4430: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_17171: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_11031: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597

Gene: OB2597_18052: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040

Gene: TM1040_2248: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Silicibacter pomeroyi DSS-3

Gene: SPO3245: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Roseobacter sp. MED193

Gene: MED193_17549: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Hyphomonas neptunium ATCC 15444

Gene: HNE_0689: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Oceanicaulis alexandrii HTCC2633

Gene: OA2633_14301: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
CRON 2.
nadE
 
Rhodobacter sphaeroides 2.4.1

Gene: RSP_2333: NAD synthetase (EC 6.3.1.5)
 
Paracoccus denitrificans PD1222

Gene: Pden_0853: NAD synthetase (EC 6.3.1.5)
 
Jannaschia sp. CCS1

Gene: Jann_3346: NAD synthetase (EC 6.3.1.5)
 
Rhodobacterales bacterium HTCC2654

Gene: RB2654_18443: NAD synthetase (EC 6.3.1.5)
 
Oceanicola granulosus HTCC2516

Gene: OG2516_08938: NAD synthetase (EC 6.3.1.5)
 
Loktanella vestfoldensis SKA53

Gene: SKA53_08994: NAD synthetase (EC 6.3.1.5)
 
Oceanicola batsensis HTCC2597

Gene: OB2597_06475: NAD synthetase (EC 6.3.1.5)
 
Roseovarius nubinhibens ISM

Gene: ISM_02210: NAD synthetase (EC 6.3.1.5)
 
Roseovarius sp. 217

Gene: ROS217_23007: NAD synthetase (EC 6.3.1.5)
 
Sulfitobacter sp. EE-36

Gene: EE36_08983: NAD synthetase (EC 6.3.1.5)
 
Silicibacter TM1040

Gene: TM1040_2278: NAD synthetase (EC 6.3.1.5)
 
Silicibacter pomeroyi DSS-3

Gene: SPO0426: NAD synthetase (EC 6.3.1.5)
 
Roseobacter sp. MED193

Gene: MED193_09830: NAD synthetase (EC 6.3.1.5)
*
Hyphomonas neptunium ATCC 15444

Site:
position = -2
score = 5.12854
sequence = AAATGCTCATCATGAGCAATA

Gene: HNE_2577: NAD synthetase (EC 6.3.1.5)
*
Oceanicaulis alexandrii HTCC2633

Site:
position = -51
score = 5.78608
sequence = AAATACTCATCCTGAGCATAA

Gene: OA2633_07784: NAD synthetase (EC 6.3.1.5)
NAD synthetase (EC 6.3.1.5)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD