Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Rhizobiales

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Sinorhizobium meliloti 1021 3 1
Rhizobium sp. NGR234 3 1
Rhizobium leguminosarum bv. viciae 3841 3 1
Rhizobium etli CFN 42 3 1
Agrobacterium tumefaciens str. C58 (Cereon) 3 1
Mesorhizobium sp. BNC1 3 1
Mesorhizobium loti MAFF303099 6 2
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009 3 1
Bradyrhizobium japonicum USDA 110 3 1
Bradyrhizobium sp. BTAi1 3 1
Nitrobacter winogradskyi Nb-255 3 1
Azorhizobium caulinodans ORS 571
Xanthobacter autotrophicus Py2 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadA
*
Sinorhizobium meliloti 1021

Site:
position = -58
score = 6.67854
sequence = TTATGCTCAGATTGAGCATAA

Gene: SMc02601: Quinolinate synthetase (EC 4.1.99.-)
*
Rhizobium sp. NGR234

Site:
position = -54
score = 6.75739
sequence = TTATGCTCATATTGAGCATAA

Gene: NGR_c08490: Quinolinate synthetase (EC 4.1.99.-)
*
Rhizobium leguminosarum bv. viciae 3841

Site:
position = -34
score = 6.16709
sequence = ATATGCTCAAACAGAGCATAA

Site:
position = -68
score = 5.57345
sequence = ATATGCTCACGGTGAGAATAT

Gene: pRL110617: Quinolinate synthetase (EC 4.1.99.-)
*
Rhizobium etli CFN 42

Site:
position = -68
score = 5.55325
sequence = ATATGCTCATAGCGAGAATAT

Site:
position = -34
score = 6.28948
sequence = ATATGCTCAAATCGAGCATAA

Gene: RHE_PE00441: Quinolinate synthetase (EC 4.1.99.-)
*
Agrobacterium tumefaciens str. C58 (Cereon)

Site:
position = -2
score = 5.90559
sequence = ATATGCTCACAATGAGAATAT

Gene: Atu4098: Quinolinate synthetase (EC 4.1.99.-)
*
Mesorhizobium sp. BNC1

Site:
position = -60
score = 5.18944
sequence = TTATGCTCAGCGCAAGCATAT

Site:
position = -34
score = 6.12011
sequence = ATATGCTCAATCGGAGCATAA

Gene: Meso_2557: Quinolinate synthetase (EC 4.1.99.-)
*2
Mesorhizobium loti MAFF303099

Site:
position = -58
score = 5.32384
sequence = TTATAGTCACAAAGATTATAA

Site:
position = -32
score = 5.09389
sequence = TTATAATCGTATAGACTATAA

Gene: mll9104: Quinolinate synthetase (EC 4.1.99.-)

Site:
position = -32
score = 5.3204
sequence = TTATAATCAGATGGACTATAA

Site:
position = -58
score = 5.16473
sequence = TTATAGTCACAACGATTATAT

Gene: mll5835: Quinolinate synthetase (EC 4.1.99.-)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
*
Rhodopseudomonas palustris CGA009

Site:
position = -186
score = 5.87146
sequence = TTATGCTCTGAATGAGGATAA

Site:
position = -48
score = 6.29777
sequence = ATATGCTCAAACTGAGTATAT

Gene: RPA1055: Quinolinate synthetase (EC 4.1.99.-)
*
Bradyrhizobium japonicum USDA 110

Site:
position = -117
score = 5.87281
sequence = ATTTACTCAGATTGAGCATAT

Site:
position = -42
score = 6.45688
sequence = ATATACTCACATTGAGCATAA

Gene: bll2542: Quinolinate synthetase (EC 4.1.99.-)
*
Bradyrhizobium sp. BTAi1

Site:
position = -111
score = 5.71719
sequence = TTATGCTCAGGATAAGTATAA

Site:
position = -84
score = 5.88797
sequence = TTATGCTCACGGAGAGTATAA

Gene: BBta_4757: Quinolinate synthetase (EC 4.1.99.-)
*
Nitrobacter winogradskyi Nb-255

Site:
position = -46
score = 6.2583
sequence = TTATACTCAATATCAGTATAA

Gene: Nwi_2424: Quinolinate synthetase (EC 4.1.99.-)
 
Azorhizobium caulinodans ORS 571
*
Xanthobacter autotrophicus Py2

Site:
position = -52
score = 5.87392
sequence = TTATGCTCAGTATAAGCATAT

Site:
position = -24
score = 5.89107
sequence = ATATGCTCAAACTGAGTATAG

Gene: Xaut_1183: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Sinorhizobium meliloti 1021

Gene: SMc02599: L-aspartate oxidase (EC 1.4.3.16)
 
Rhizobium sp. NGR234

Gene: NGR_c08500: L-aspartate oxidase (EC 1.4.3.16)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL110616: L-aspartate oxidase (EC 1.4.3.16)
 
Rhizobium etli CFN 42

Gene: RHE_PE00440: L-aspartate oxidase (EC 1.4.3.16)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4097: L-aspartate oxidase (EC 1.4.3.16)
 
Mesorhizobium sp. BNC1

Gene: Meso_2556: L-aspartate oxidase (EC 1.4.3.16)
 2
Mesorhizobium loti MAFF303099

Gene: mll9103: L-aspartate oxidase (EC 1.4.3.16)

Gene: mll5834: L-aspartate oxidase (EC 1.4.3.16)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1054: L-aspartate oxidase (EC 1.4.3.16)
 
Bradyrhizobium japonicum USDA 110

Gene: bll2541: L-aspartate oxidase (EC 1.4.3.16)
 2
Bradyrhizobium sp. BTAi1

Gene: BBta_2362: L-aspartate oxidase (EC 1.4.3.16)

Gene: BBta_4756: L-aspartate oxidase (EC 1.4.3.16)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2425: L-aspartate oxidase (EC 1.4.3.16)
 
Azorhizobium caulinodans ORS 571
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1182: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Sinorhizobium meliloti 1021

Gene: SMc02598: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Rhizobium sp. NGR234

Gene: NGR_c08510: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Rhizobium leguminosarum bv. viciae 3841

Gene: pRL110615: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Rhizobium etli CFN 42

Gene: RHE_PE00439: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Agrobacterium tumefaciens str. C58 (Cereon)

Gene: Atu4096: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Mesorhizobium sp. BNC1

Gene: Meso_2555: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 3
Mesorhizobium loti MAFF303099

Gene: mll6272: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Gene: mll9102: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Gene: mll5833: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Brucella melitensis 16M
 
Bartonella quintana str. Toulouse
 
Rhodopseudomonas palustris CGA009

Gene: RPA1053: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bradyrhizobium japonicum USDA 110

Gene: bll2540: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bradyrhizobium sp. BTAi1

Gene: BBta_4755: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Nitrobacter winogradskyi Nb-255

Gene: Nwi_2426: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Azorhizobium caulinodans ORS 571

Gene: AZC_2468: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Xanthobacter autotrophicus Py2

Gene: Xaut_1181: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD