Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Various betaproteobacteria

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Azoarcus sp. EbN1
Thauera sp. MZ1T
Dechloromonas aromatica RCB
Nitrosomonas europaea ATCC 19718
Nitrosospira multiformis ATCC 25196
Thiobacillus denitrificans
Chromobacterium violaceum ATCC 12472
Neisseria meningitidis MC58 5 2
Laribacter hongkongensis HLHK9
Methylobacillus flagellatus KT
Methylotenera mobilis JLW8
Methylophilales bacterium HTCC2181
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadQ
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
*
Neisseria meningitidis MC58

Site:
position = -132
score = 6.4851
sequence = TTATGCTCAACTTGAGTATAA

Gene: NMB0395: Transcriptional regulator of NAD metabolism, COG4111 family
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Transcriptional regulator of NAD metabolism, COG4111 family
nadC
 
Azoarcus sp. EbN1

Gene: ebA4956: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Thauera sp. MZ1T

Gene: Tmz1t_2571: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Dechloromonas aromatica RCB

Gene: Daro_2380: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Nitrosomonas europaea ATCC 19718

Gene: NE2122: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A1543: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Thiobacillus denitrificans

Gene: Tbd_0814: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Chromobacterium violaceum ATCC 12472

Gene: CV1588: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Neisseria meningitidis MC58

Gene: NMB0396: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Laribacter hongkongensis HLHK9

Gene: LHK_01834: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Methylobacillus flagellatus KT

Gene: Mfla_2117: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Methylotenera mobilis JLW8

Gene: Mmol_0620: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Methylophilales bacterium HTCC2181

Gene: MB2181_05835: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
CRON 2.
nadA
 
Azoarcus sp. EbN1

Gene: ebA4125: Quinolinate synthetase (EC 4.1.99.-)
 
Thauera sp. MZ1T

Gene: Tmz1t_3645: Quinolinate synthetase (EC 4.1.99.-)
 
Dechloromonas aromatica RCB

Gene: Daro_3766: Quinolinate synthetase (EC 4.1.99.-)
 
Nitrosomonas europaea ATCC 19718

Gene: NE0066: Quinolinate synthetase (EC 4.1.99.-)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A0605: Quinolinate synthetase (EC 4.1.99.-)
 
Thiobacillus denitrificans

Gene: Tbd_0221: Quinolinate synthetase (EC 4.1.99.-)
 
Chromobacterium violaceum ATCC 12472

Gene: CV3678: Quinolinate synthetase (EC 4.1.99.-)
*
Neisseria meningitidis MC58

Site:
position = -90
score = 6.4851
sequence = TTATACTCAAGTTGAGCATAA

Gene: NMB0394: Quinolinate synthetase (EC 4.1.99.-)
 
Laribacter hongkongensis HLHK9

Gene: LHK_00357: Quinolinate synthetase (EC 4.1.99.-)
 
Methylobacillus flagellatus KT

Gene: Mfla_2381: Quinolinate synthetase (EC 4.1.99.-)
 
Methylotenera mobilis JLW8

Gene: Mmol_2281: Quinolinate synthetase (EC 4.1.99.-)
 
Methylophilales bacterium HTCC2181

Gene: MB2181_01380: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
NMB0393
 
Azoarcus sp. EbN1
 
Thauera sp. MZ1T
 
Dechloromonas aromatica RCB
 
Nitrosomonas europaea ATCC 19718
 
Nitrosospira multiformis ATCC 25196
 
Thiobacillus denitrificans
 
Chromobacterium violaceum ATCC 12472
 
Neisseria meningitidis MC58

Gene: NMB0393: Ethidium bromide-methyl viologen resistance protein EmrE
 
Laribacter hongkongensis HLHK9
 
Methylobacillus flagellatus KT
 
Methylotenera mobilis JLW8
 
Methylophilales bacterium HTCC2181
Ethidium bromide-methyl viologen resistance protein EmrE
nadB
 
Azoarcus sp. EbN1

Gene: ebA5461: L-aspartate oxidase (EC 1.4.3.16)
 
Thauera sp. MZ1T

Gene: Tmz1t_2322: L-aspartate oxidase (EC 1.4.3.16)
 
Dechloromonas aromatica RCB

Gene: Daro_2021: L-aspartate oxidase (EC 1.4.3.16)
 
Nitrosomonas europaea ATCC 19718

Gene: NE1892: L-aspartate oxidase (EC 1.4.3.16)
 
Nitrosospira multiformis ATCC 25196

Gene: Nmul_A1743: L-aspartate oxidase (EC 1.4.3.16)
 
Thiobacillus denitrificans

Gene: Tbd_2096: L-aspartate oxidase (EC 1.4.3.16)
 
Chromobacterium violaceum ATCC 12472

Gene: CV3930: L-aspartate oxidase (EC 1.4.3.16)
 
Neisseria meningitidis MC58

Gene: NMB0392: L-aspartate oxidase (EC 1.4.3.16)
 
Laribacter hongkongensis HLHK9

Gene: LHK_00001: L-aspartate oxidase (EC 1.4.3.16)
 2
Methylobacillus flagellatus KT

Gene: Mfla_0999: L-aspartate oxidase (EC 1.4.3.16)

Gene: Mfla_0855: L-aspartate oxidase (EC 1.4.3.16)
 
Methylotenera mobilis JLW8

Gene: Mmol_1642: L-aspartate oxidase (EC 1.4.3.16)
 
Methylophilales bacterium HTCC2181

Gene: MB2181_02955: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD