Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Comamonadaceae

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/beta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42
Comamonas testosteroni KF-1 4 2
Delftia acidovorans SPH-1 4 2
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1
Leptothrix cholodnii SP-6
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadC
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_3851: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Acidovorax sp. JS42

Gene: Ajs_3498: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
*
Comamonas testosteroni KF-1

Site:
position = -91
score = 5.70257
sequence = TAATGCTCAGATTTAGCATAA

Site:
position = -11
score = 5.78777
sequence = AAATACTCAAAATGAGCATTA

Gene: CtesDRAFT_2977: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
*
Delftia acidovorans SPH-1

Site:
position = -11
score = 6.16175
sequence = ATATACTCAAAATGAGCATTA

Site:
position = -81
score = 5.45074
sequence = TTATGCTCGTATCTAGCATAA

Gene: Daci_1541: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 2
Polaromonas naphthalenivorans CJ2

Gene: Pnap_4632: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)

Gene: Pnap_0937: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Polaromonas sp. JS666

Gene: Bpro_0902: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1318: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Variovorax paradoxus S110

Gene: Vapar_4098: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1553: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Leptothrix cholodnii SP-6

Gene: Lcho_1909: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
CtesDRAFT_3519
 
Acidovorax avenae subsp. citrulli AAC00-1
 
Acidovorax sp. JS42
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_3519: Uncharacterized protein UPF0065
 
Delftia acidovorans SPH-1

Gene: Daci_1542: Uncharacterized protein UPF0065
 
Polaromonas naphthalenivorans CJ2
 
Polaromonas sp. JS666
 
Rhodoferax ferrireducens DSM 15236
 
Variovorax paradoxus S110
 
Verminephrobacter eiseniae EF01-2
 
Methylibium petroleiphilum PM1
 
Leptothrix cholodnii SP-6
Uncharacterized protein UPF0065
 
CRON 2.
nadA
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_3850: Quinolinate synthetase (EC 4.1.99.-)
 
Acidovorax sp. JS42

Gene: Ajs_3497: Quinolinate synthetase (EC 4.1.99.-)
*
Comamonas testosteroni KF-1

Site:
position = -52
score = 6.17945
sequence = TAATACTCAGATTGAGTATAA

Gene: CtesDRAFT_2575: Quinolinate synthetase (EC 4.1.99.-)
*
Delftia acidovorans SPH-1

Site:
position = -67
score = 6.20528
sequence = TAATACTCAAATTGAGCATAT

Gene: Daci_2150: Quinolinate synthetase (EC 4.1.99.-)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0938: Quinolinate synthetase (EC 4.1.99.-)
 
Polaromonas sp. JS666

Gene: Bpro_0903: Quinolinate synthetase (EC 4.1.99.-)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_1319: Quinolinate synthetase (EC 4.1.99.-)
 
Variovorax paradoxus S110

Gene: Vapar_4097: Quinolinate synthetase (EC 4.1.99.-)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_0026: Quinolinate synthetase (EC 4.1.99.-)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1554: Quinolinate synthetase (EC 4.1.99.-)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2015: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Acidovorax avenae subsp. citrulli AAC00-1

Gene: Aave_3840: L-aspartate oxidase (EC 1.4.3.16)
 
Acidovorax sp. JS42

Gene: Ajs_3493: L-aspartate oxidase (EC 1.4.3.16)
 
Comamonas testosteroni KF-1

Gene: CtesDRAFT_2576: L-aspartate oxidase (EC 1.4.3.16)
 
Delftia acidovorans SPH-1

Gene: Daci_2149: L-aspartate oxidase (EC 1.4.3.16)
 
Polaromonas naphthalenivorans CJ2

Gene: Pnap_0956: L-aspartate oxidase (EC 1.4.3.16)
 
Polaromonas sp. JS666

Gene: Bpro_0905: L-aspartate oxidase (EC 1.4.3.16)
 
Rhodoferax ferrireducens DSM 15236

Gene: Rfer_3031: L-aspartate oxidase (EC 1.4.3.16)
 
Variovorax paradoxus S110

Gene: Vapar_4092: L-aspartate oxidase (EC 1.4.3.16)
 
Verminephrobacter eiseniae EF01-2

Gene: Veis_1080: L-aspartate oxidase (EC 1.4.3.16)
 
Methylibium petroleiphilum PM1

Gene: Mpe_A1551: L-aspartate oxidase (EC 1.4.3.16)
 
Leptothrix cholodnii SP-6

Gene: Lcho_2017: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD