Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NadQ - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: NadQ
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector:
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1
Acinetobacter baumannii AB0057
Psychrobacter arcticum 273-4 4 3
Psychrobacter sp. PRwf-1 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nadQ
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
*
Psychrobacter arcticum 273-4

Site:
position = -186
score = 6.75739
sequence = TTATGCTCATTTTGAGCATAA

Gene: Psyc_0633: Transcriptional regulator of NAD metabolism, COG4111 family
*
Psychrobacter sp. PRwf-1

Site:
position = -337
score = 6.69484
sequence = TTATGCTCATTTTGAGTATAA

Gene: PsycPRwf_1963: Transcriptional regulator of NAD metabolism, COG4111 family
Transcriptional regulator of NAD metabolism, COG4111 family
 
CRON 2.
nadA
 
Acinetobacter sp. ADP1

Gene: ACIAD0651: Quinolinate synthetase (EC 4.1.99.-)
 
Acinetobacter baumannii AB0057

Gene: AB57_0762: Quinolinate synthetase (EC 4.1.99.-)
*
Psychrobacter arcticum 273-4

Site:
position = -107
score = 6.75739
sequence = TTATGCTCAAAATGAGCATAA

Gene: Psyc_0632: Quinolinate synthetase (EC 4.1.99.-)
*
Psychrobacter sp. PRwf-1

Site:
position = -105
score = 6.69484
sequence = TTATACTCAAAATGAGCATAA

Gene: PsycPRwf_1964: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Acinetobacter sp. ADP1

Gene: ACIAD2587: L-aspartate oxidase (EC 1.4.3.16)
 
Acinetobacter baumannii AB0057

Gene: AB57_2967: L-aspartate oxidase (EC 1.4.3.16)
 
Psychrobacter arcticum 273-4

Gene: Psyc_0631: L-aspartate oxidase (EC 1.4.3.16)
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_1965: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
 
CRON 3.
nadC
 
Acinetobacter sp. ADP1

Gene: ACIAD0062: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Acinetobacter baumannii AB0057

Gene: AB57_0085: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
*
Psychrobacter arcticum 273-4

Site:
position = -83
score = 6.19953
sequence = TTATGCTCATTTTGAGTTTAA

Gene: Psyc_0634: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
*
Psychrobacter sp. PRwf-1

Site:
position = -148
score = 6.33988
sequence = TTATGCTCATAATGAGCATTA

Gene: PsycPRwf_1962: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD