Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Caulobacterales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31 3 2
Phenylobacterium zucineum HLK1 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
coxA
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31
*
Phenylobacterium zucineum HLK1

Site:
position = -41
score = 2.71495
sequence = AGATGTATCCCCGATATATCT

Gene: PHZ_c3176: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
nsrR
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -109
score = 4.89943
sequence = TGATGCTTATCAAATGCATCT

Gene: Caul_0854: Nitrite-sensitive transcriptional repressor NsrR
 
Phenylobacterium zucineum HLK1

Gene: PHZ_c3177: Nitrite-sensitive transcriptional repressor NsrR
Nitrite-sensitive transcriptional repressor NsrR
 
CRON 2.
PF09313
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
*
Caulobacter sp. K31

Site:
position = -34
score = 4.89943
sequence = AGATGCATTTGATAAGCATCA

Gene: Caul_0855: Truncated hemoglobins
 
Phenylobacterium zucineum HLK1
Truncated hemoglobins
hmp
 
Caulobacter crescentus CB15
 
Caulobacter segnis ATCC 21756
 
Caulobacter sp. K31

Gene: Caul_0856: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Phenylobacterium zucineum HLK1
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD