Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Moraxellaceae

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Acinetobacter sp. ADP1 2 1
Acinetobacter baumannii AB0057 2 1
Psychrobacter arcticum 273-4
Psychrobacter sp. PRwf-1 3 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
norB
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -188
score = 6.54553
sequence = ACATTCATTTTAAATGAATGT

Site:
position = -53
score = 6.7784
sequence = ACATTCATTTTAAATGAATCT

Gene: PsycPRwf_1520: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
 
CRON 2.
nnrS
 
Acinetobacter sp. ADP1
 
Acinetobacter baumannii AB0057
 
Psychrobacter arcticum 273-4

Gene: Psyc_1348: NnrS protein involved in response to NO
*
Psychrobacter sp. PRwf-1

Site:
position = -135
score = 6.27423
sequence = ACATTCATTATAAATACATCT

Gene: PsycPRwf_0765: NnrS protein involved in response to NO
NnrS protein involved in response to NO
 
CRON 3.
hmp
*
Acinetobacter sp. ADP1

Site:
position = -72
score = 6.35056
sequence = AGATGCATTGCAAATACATCT

Site:
position = -47
score = 5.41848
sequence = AAATGTATTTTGAATATATCT

Gene: ACIAD3226: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
*
Acinetobacter baumannii AB0057

Site:
position = -49
score = 6.68081
sequence = AGATGTATTTTAAATACATCT

Gene: AB57_3535: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Psychrobacter arcticum 273-4
*
Psychrobacter sp. PRwf-1

Site:
position = -142
score = 6.90889
sequence = AGATTCATTTGAAATGAATCT

Gene: PsycPRwf_0670: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
nsrR
 
Acinetobacter sp. ADP1

Gene: ACIAD3227: Nitrite-sensitive transcriptional repressor NsrR
 
Acinetobacter baumannii AB0057

Gene: AB57_3536: Nitrite-sensitive transcriptional repressor NsrR
 
Psychrobacter arcticum 273-4
 
Psychrobacter sp. PRwf-1

Gene: PsycPRwf_0763: Nitrite-sensitive transcriptional repressor NsrR
Nitrite-sensitive transcriptional repressor NsrR
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD