Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Oceanospirillales/Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40 2 1
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107 4 2
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297 3 2
Alcanivorax borkumensis SK2 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DUF454
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_3072: Hypothetical protein DUF454
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
*
Cellvibrio japonicus Ueda107

Site:
position = -50
score = 5.4342
sequence = AGATGCAAAATAAATGAATCT

Gene: CJA_1547: Hypothetical protein DUF454
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Hypothetical protein DUF454
nnrS
 
Hahella chejuensis KCTC 2396

Gene: HCH_01371: NnrS protein involved in response to NO
 
Marinobacter aqueolei

Gene: Maqu_3145: NnrS protein involved in response to NO
 
Marinobacter sp. ELB17

Gene: MELB17_04242: NnrS protein involved in response to NO
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
*
Saccharophagus degradans 2-40

Site:
position = -82
score = 4.90917
sequence = AGATGTAATATACATGCATCT

Site:
position = -56
score = 5.25764
sequence = AGATGCATAATAAATGTATCT

Gene: Sde_0102: NnrS protein involved in response to NO
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_1548: NnrS protein involved in response to NO
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297

Gene: MED297_07536: NnrS protein involved in response to NO
 
Alcanivorax borkumensis SK2

Gene: ABO_2561: NnrS protein involved in response to NO
NnrS protein involved in response to NO
nsrR
 
Hahella chejuensis KCTC 2396
 
Marinobacter aqueolei

Gene: Maqu_3071: Nitrite-sensitive transcriptional repressor NsrR
 
Marinobacter sp. ELB17

Gene: MELB17_04687: Nitrite-sensitive transcriptional repressor NsrR
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40

Gene: Sde_0101: Nitrite-sensitive transcriptional repressor NsrR
 
Teredinibacter turnerae T7901
 
Cellvibrio japonicus Ueda107

Gene: CJA_1549: Nitrite-sensitive transcriptional repressor NsrR
 
Chromohalobacter salexigens DSM 3043
*2
Reinekea sp. MED297

Site:
position = -44
score = 5.49759
sequence = AGATGTATATTAAATGCATCT

Gene: MED297_07531: Nitrite-sensitive transcriptional repressor NsrR

Site:
position = -193
score = 4.07904
sequence = AAATGTAATTTAATTACATAA

Gene: MED297_17612: Nitrite-sensitive transcriptional repressor NsrR
*
Alcanivorax borkumensis SK2

Site:
position = -27
score = 4.10211
sequence = AGATACTCATTTTTTGGAGGT

Gene: ABO_2120: Nitrite-sensitive transcriptional repressor NsrR
Nitrite-sensitive transcriptional repressor NsrR
hmp
 
Hahella chejuensis KCTC 2396

Gene: HCH_01369: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1

Gene: Mmwyl1_0066: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901

Gene: TERTU_0471: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Cellvibrio japonicus Ueda107
 
Chromohalobacter salexigens DSM 3043

Gene: Csal_0452: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Reinekea sp. MED297
*
Alcanivorax borkumensis SK2

Site:
position = -84
score = 4.10211
sequence = ACCTCCAAAAAATGAGTATCT

Gene: ABO_2119: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
CRON 2.
norB
 
Hahella chejuensis KCTC 2396

Gene: HCH_00713: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
 
Marinobacter aqueolei
 
Marinobacter sp. ELB17
 
Oceanobacter sp. RED65
 
Oceanospirillum sp. MED92
 
Marinomonas sp. MWYL1
 
Saccharophagus degradans 2-40
 
Teredinibacter turnerae T7901
*
Cellvibrio japonicus Ueda107

Site:
position = -88
score = 5.4342
sequence = AGATTCATTTATTTTGCATCT

Gene: CJA_1546: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
 
Chromohalobacter salexigens DSM 3043
 
Reinekea sp. MED297
 
Alcanivorax borkumensis SK2
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD