Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Psychromonadaceae/Aeromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Psychromonas ingrahamii 37 3 2
Psychromonas sp. CNPT3 2 2
Moritella sp. PE36
Aeromonas hydrophila subsp. hydrophila ATCC 7966
Aeromonas salmonicida subsp. salmonicida A449
Tolumonas auensis DSM 9187
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nsrR
*
Psychromonas ingrahamii 37

Site:
position = -49
score = 5.22459
sequence = AGATGTAAAATAAATACATCT

Gene: Ping_0631: Nitrite-sensitive transcriptional repressor NsrR
*
Psychromonas sp. CNPT3

Site:
position = -86
score = 5.00719
sequence = AGTTGCATTTAAAATACATGT

Gene: PCNPT3_03591: Nitrite-sensitive transcriptional repressor NsrR
 
Moritella sp. PE36

Gene: PE36_21894: Nitrite-sensitive transcriptional repressor NsrR
 2
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0250: Nitrite-sensitive transcriptional repressor NsrR

Gene: AHA_0662: Nitrite-sensitive transcriptional repressor NsrR
 2
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_4148: Nitrite-sensitive transcriptional repressor NsrR

Gene: ASA_0662: Nitrite-sensitive transcriptional repressor NsrR
 2
Tolumonas auensis DSM 9187

Gene: Tola_0148: Nitrite-sensitive transcriptional repressor NsrR

Gene: Tola_1822: Nitrite-sensitive transcriptional repressor NsrR
Nitrite-sensitive transcriptional repressor NsrR
nnrS
 
Psychromonas ingrahamii 37

Gene: Ping_0630: NnrS protein involved in response to NO
 
Psychromonas sp. CNPT3

Gene: PCNPT3_11823: NnrS protein involved in response to NO
 
Moritella sp. PE36

Gene: PE36_13469: NnrS protein involved in response to NO
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_3945: NnrS protein involved in response to NO
 
Aeromonas salmonicida subsp. salmonicida A449
 
Tolumonas auensis DSM 9187
NnrS protein involved in response to NO
 
CRON 2.
hmp
*
Psychromonas ingrahamii 37

Site:
position = -63
score = 4.24931
sequence = ATATGCATTTAAGATGCCTCT

Site:
position = -33
score = 4.45857
sequence = AGAAGTATTTTAAATGCATAT

Gene: Ping_2905: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
*
Psychromonas sp. CNPT3

Site:
position = -36
score = 5.00719
sequence = ACATGTATTTTAAATGCAACT

Gene: PCNPT3_03586: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Moritella sp. PE36

Gene: PE36_10688: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Aeromonas hydrophila subsp. hydrophila ATCC 7966

Gene: AHA_0661: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Aeromonas salmonicida subsp. salmonicida A449

Gene: ASA_0661: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
 
Tolumonas auensis DSM 9187
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD