Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog NsrR - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125 2 2
Pseudoalteromonas tunicata D2
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
norB
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -191
score = 5.41907
sequence = ACATGCATTTTGTTTGCATGT

Gene: PSHAa2417: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR

Gene: IL0186: Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
Nitric-oxide reductase (EC 1.7.99.7), quinol-dependent
 
CRON 2.
nsrR
 
Pseudoalteromonas atlantica T6c
 
Alteromonas macleodii 'Deep ecotype'
 
Glaciecola sp. HTCC2999
 
Colwellia psychrerythraea 34H
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -132
score = 5.41907
sequence = ACATGCAAACAAAATGCATGT

Gene: PSHAa2419: Rrf2 family nitrosative stress transcriptional regulator, NO-sensitive
 
Pseudoalteromonas tunicata D2
 
Idiomarina baltica OS145
 
Idiomarina loihiensis L2TR
Rrf2 family nitrosative stress transcriptional regulator, NO-sensitive
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD