Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SmtB - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Zinc resistance
Effector: Zinc ion, (Zn2+)
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cyanothece sp. ATCC 51142
Cyanothece sp. PCC 7425 1 1
Cyanothece sp. PCC 8801 1 1
Gloeobacter violaceus PCC 7421
Microcystis aeruginosa NIES-843 1 1
Nostoc sp. PCC 7120 2 2
Prochlorococcus marinus str. MIT 9313
Synechococcus elongatus PCC 7942 2 2
Synechococcus sp. JA-3-3Ab
Synechococcus sp. PCC 7002 2 2
Synechococcus sp. WH 8102
Synechocystis sp. PCC 6803 2 2
Thermosynechococcus elongatus BP-1 1 1
Trichodesmium erythraeum IMS101
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
smtB
 
Cyanothece sp. ATCC 51142
*
Cyanothece sp. PCC 7425

Site:
position = -124
score = 7.26883
sequence = AACATCTGAACAACTGTTCATATGTT

Gene: Cyan7425_4462: Zinc stress transcriptional regulator, ArsR family
 
Cyanothece sp. PCC 8801

Gene: PCC8801_0860: Zinc stress transcriptional regulator, ArsR family
 
Gloeobacter violaceus PCC 7421
*
Microcystis aeruginosa NIES-843

Site:
position = -269
score = 6.65832
sequence = AATCCATGAACATCTGTTCAGATGTT

Gene: MAE_02380: Zinc stress transcriptional regulator, ArsR family
*2
Nostoc sp. PCC 7120

Site:
position = -85
score = 6.43055
sequence = AACAATTGAACAACTATTCAATTGTA

Gene: all7621 (deprecated): Zinc stress transcriptional regulator, ArsR family

Gene: alr0831: Zinc stress transcriptional regulator, ArsR family
 
Prochlorococcus marinus str. MIT 9313
*
Synechococcus elongatus PCC 7942

Site:
position = -84
score = 7.12847
sequence = AATATCTGAATAACTGTTCATGTGTT

Site:
position = -52
score = 6.27829
sequence = AACATCTGAATCTTGATTCAGGTATG

Gene: Synpcc7942_1291: Zinc stress transcriptional regulator, ArsR family
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. PCC 7002

Site:
position = -43
score = 7.20512
sequence = AACACATGAACAATTATTCAGGTATT

Site:
position = -75
score = 6.17635
sequence = AATAGTTGAACGATTGTTCACATTTT

Gene: SYNPCC7002_A2564: Zinc stress transcriptional regulator, ArsR family
 
Synechococcus sp. WH 8102
*
Synechocystis sp. PCC 6803

Site:
position = -97
score = 6.52555
sequence = AACACCTGAAGATATGCTCAGATATT

Gene: sll0792: Zinc stress transcriptional regulator, ArsR family
 
Thermosynechococcus elongatus BP-1

Gene: tlr1018: Zinc stress transcriptional regulator, ArsR family
 
Trichodesmium erythraeum IMS101
Zinc stress transcriptional regulator, ArsR family
 
CRON 2.
smtA
 
Cyanothece sp. ATCC 51142

Gene: cce_2496: Metallothionein
 
Cyanothece sp. PCC 7425
*
Cyanothece sp. PCC 8801

Site:
position = -71
score = 6.92871
sequence = AATATCTGAATACCTGTTCAGATGTT

Gene: PCC8801_0861: Metallothionein
 
Gloeobacter violaceus PCC 7421

Gene: gsl3430: Metallothionein
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
*
Synechococcus elongatus PCC 7942

Site:
position = -74
score = 6.27829
sequence = CATACCTGAATCAAGATTCAGATGTT

Site:
position = -42
score = 7.12847
sequence = AACACATGAACAGTTATTCAGATATT

Gene: Synpcc7942_1290: Metallothionein
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. PCC 7002

Site:
position = -85
score = 7.20512
sequence = AATACCTGAATAATTGTTCATGTGTT

Site:
position = -53
score = 6.17635
sequence = AAAATGTGAACAATCGTTCAACTATT

Gene: SYNPCC7002_A2563: Metallothionein
 
Synechococcus sp. WH 8102

Gene: SYNW0359: Metallothionein
 
Synechocystis sp. PCC 6803
*
Thermosynechococcus elongatus BP-1

Site:
position = -79
score = 5.94937
sequence = GACGTATGAACAGTTGTTCAAGTATA

Gene: tsl1016 (deprecated): Metallothionein
 
Trichodesmium erythraeum IMS101
Metallothionein
 
CRON 3.
ziaA
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
*
Synechocystis sp. PCC 6803

Site:
position = -80
score = 6.52555
sequence = AATATCTGAGCATATCTTCAGGTGTT

Gene: slr0798: Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
Zinc-transporting ATPase (EC 3.6.3.5) (Zn(2 )-translocating P-type ATPase)
 
CRON 4.
alr7622
 
Cyanothece sp. ATCC 51142
 
Cyanothece sp. PCC 7425
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
*
Nostoc sp. PCC 7120

Site:
position = 13
score = 6.43055
sequence = TACAATTGAATAGTTGTTCAATTGTT

Gene: alr7622 (deprecated): Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
 
Synechococcus sp. PCC 7002
 
Synechococcus sp. WH 8102
 
Synechocystis sp. PCC 6803
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD