Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Corynebacteriaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 38 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Corynebacterium amycolatum SK46 9 3
Corynebacterium aurimucosum ATCC 700975 8 4
Corynebacterium diphtheriae NCTC 13129 10 6
Corynebacterium efficiens YS-314 3 1
Corynebacterium glutamicum ATCC 13032 10 7
Corynebacterium jeikeium K411 9 3
Corynebacterium kroppenstedtii DSM 44385 4 2
Corynebacterium urealyticum DSM 7109 12 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
yciC
*
Corynebacterium amycolatum SK46

Site:
position = -36
score = 5.42229
sequence = TATTGATAAGCATTTTCAGTA

Gene: CORAM0001_0703: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -25
score = 5.96824
sequence = TGATGAAAACCGTTATCATTA

Gene: cauri_0148: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -25
score = 5.10612
sequence = AAGTGAAAACGGTATCCATTA

Gene: DIP1486: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -79
score = 6.05065
sequence = TATTGAAAACAATTTCCATTA

Site:
position = -34
score = 5.27347
sequence = TATTGAAAATGATTCCCAAAA

Gene: cg0794: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Corynebacterium jeikeium K411

Site:
position = -40
score = 5.2288
sequence = TGATGAAAACAGGTTGCAATA

Gene: jk1292: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -164
score = 5.09335
sequence = TATTGACATTGTGTATCATTA

Gene: ckrop_1235: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Corynebacterium urealyticum DSM 7109
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 2.
znuA
*
Corynebacterium amycolatum SK46

Site:
position = -85
score = 5.40811
sequence = AAAGGACAACTGTTTTCAATA

Gene: CORAM0001_1250: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -39
score = 5.08166
sequence = ATTTGACAACAATTTTCACTA

Gene: cauri_2206: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Corynebacterium diphtheriae NCTC 13129
*
Corynebacterium efficiens YS-314

Site:
position = 1
score = 5.77025
sequence = TGTTGACAATCGTTTCCAATA

Gene: CE2512: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -38
score = 5.43721
sequence = TGTTGACATCCTTTTTCAATA

Gene: cg2911: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium jeikeium K411

Site:
position = 40
score = 4.99347
sequence = TgAaGAAAATGgTTgcCAaTt

Gene: jk0328: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium kroppenstedtii DSM 44385

Site:
position = -38
score = 5.05233
sequence = AATTGACATCATATTTCATTA

Gene: ckrop_0347: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium urealyticum DSM 7109

Site:
position = -43
score = 5.0514
sequence = TATTGCAATCTGTTCCCATTA

Gene: cur_1662: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1251: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_2207: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2513: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2912: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium jeikeium K411

Gene: jk0327: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0346: Zinc ABC transporter, ATP-binding protein ZnuC
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1663: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_1252: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_2208: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314

Gene: CE2514: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium glutamicum ATCC 13032

Gene: cg2913: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium jeikeium K411

Gene: jk0326: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium kroppenstedtii DSM 44385

Gene: ckrop_0345: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1664: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
 
CRON 3.
adhA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -37
score = 5.47802
sequence = TATTGAAAATAGGTACCATTA

Gene: DIP2114: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
 
Corynebacterium efficiens YS-314

Gene: CE0053: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -317
score = 5.69017
sequence = AATTGAAAAACATTTCCATTA

Gene: cg3107: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -98
score = 4.7507
sequence = TAATGGGAACTATACTCATTA

Gene: cur_1829: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
 
CRON 4.
mntA
*
Corynebacterium amycolatum SK46

Site:
position = -143
score = 4.36576
sequence = GGTTGAAAATGCTTGTCGTTA

Gene: CORAM0001_0534: putative manganese ABC transporter, substrate-binding protein
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0615: putative manganese ABC transporter, substrate-binding protein
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -40
score = 5.31441
sequence = TATTGACAAAGAGTGCCATTA

Site:
position = 4
score = 5.26642
sequence = TACTGAAAGACATTTTCAATA

Gene: cg0041: putative manganese ABC transporter, substrate-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -128
score = 5.2542
sequence = TAATGGAAAACAGTGCCATTA

Gene: cur_1147: putative manganese ABC transporter, substrate-binding protein
putative manganese ABC transporter, substrate-binding protein
mntB
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0535: putative manganese ABC transporter, ATP-binding protein
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0616: putative manganese ABC transporter, ATP-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1146: putative manganese ABC transporter, ATP-binding protein
putative manganese ABC transporter, ATP-binding protein
mntC
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0536: putative manganese ABC transporter, permease component
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0617: putative manganese ABC transporter, permease component
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1145: putative manganese ABC transporter, permease component
putative manganese ABC transporter, permease component
mntD
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0537: putative manganese ABC transporter, permease component 2
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0618: putative manganese ABC transporter, permease component 2
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_1144: putative manganese ABC transporter, permease component 2
putative manganese ABC transporter, permease component 2
mntR
 
Corynebacterium amycolatum SK46

Gene: CORAM0001_0538: Manganese-dependent transcriptional regulator MntR
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0619: Manganese-dependent transcriptional regulator MntR
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Manganese-dependent transcriptional regulator MntR
sapD
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1145: putative surface-anchored protein
*2
Corynebacterium diphtheriae NCTC 13129

Site:
position = -68
score = 5.24989
sequence = AATTGACATCGGATTCCAATA

Site:
position = -30
score = 4.41734
sequence = AATTGCAAATCTAAATCAATA

Gene: DIP1724: putative surface-anchored protein

Gene: DIP0443: putative surface-anchored protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
*
Corynebacterium jeikeium K411

Site:
position = -75
score = 4.37991
sequence = GTTTGAAAATGGTTGCCACTT

Site:
position = -42
score = 4.23974
sequence = TAATGAAAACTAGACTCATTG

Gene: jk1856: putative surface-anchored protein
 
Corynebacterium kroppenstedtii DSM 44385
*
Corynebacterium urealyticum DSM 7109

Site:
position = -160
score = 5.05348
sequence = AAAGGAAAACCATTGCCAATT

Site:
position = -103
score = 5.03567
sequence = ACTTGAAAATGGCTGTCATTA

Gene: cur_0291: putative surface-anchored protein
putative surface-anchored protein
troA
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1144: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -69
score = 4.93391
sequence = TAATGAAAATGATTGTGATGT

Gene: DIP0438: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1855: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0292: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
DIP0439
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0439: Putative membrane protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1854: Putative membrane protein
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Putative membrane protein
DIP0440
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1143: putative ABC transport system, ATP-binding protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0440: putative ABC transport system, ATP-binding protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411

Gene: jk1853: putative ABC transport system, ATP-binding protein
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0293: putative ABC transport system, ATP-binding protein
putative ABC transport system, ATP-binding protein
DIP0441
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975

Gene: cauri_1142: putative ABC transport system, permease protein
 
Corynebacterium diphtheriae NCTC 13129

Gene: DIP0441: putative ABC transport system, permease protein
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -25
score = 5.85691
sequence = TAATGATAACGGTTATCATTT

Site:
position = -19
score = 4.20691
sequence = TAACGGTTATCATTTTCAAAT

Gene: cg0042: putative ABC transport system, permease protein
 
Corynebacterium jeikeium K411

Gene: jk1852: putative ABC transport system, permease protein
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109

Gene: cur_0294: putative ABC transport system, permease protein
putative ABC transport system, permease protein
cmrA
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -116
score = 4.44234
sequence = AATTGAACCCTGTTTCCACTA

Site:
position = -67
score = 4.36061
sequence = TAACGGGACTGAATTCCATTA

Gene: cauri_1146: hypothetical protein
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
hypothetical protein
cg0040
 
Corynebacterium amycolatum SK46
*
Corynebacterium aurimucosum ATCC 700975

Site:
position = -39
score = 4.8146
sequence = TATTGCTATTGATTTTCACTT

Gene: cauri_0852: putative secreted protein
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032

Gene: cg0040: putative secreted protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
putative secreted protein
DIP0442
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -84
score = 4.95415
sequence = TATTGGTTATCTTTTTCATTT

Gene: DIP0442: Putative membrane protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
Putative membrane protein
znuC2
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -25
score = 5.85691
sequence = AAATGATAACCGTTATCATTA

Gene: cg0043: zinc ABC transporter, ATP-binding protein
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
zinc ABC transporter, ATP-binding protein
 
CRON 5.
cg0795
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
 
Corynebacterium diphtheriae NCTC 13129
 
Corynebacterium efficiens YS-314
*
Corynebacterium glutamicum ATCC 13032

Site:
position = -105
score = 5.27347
sequence = TTTTGGGAATCATTTTCAATA

Site:
position = -60
score = 6.05065
sequence = TAATGGAAATTGTTTTCAATA

Gene: cg0795: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
FAD-dependent pyridine nucleotide-disulphide oxidoreductase
 
CRON 6.
cmra
 
Corynebacterium amycolatum SK46
 
Corynebacterium aurimucosum ATCC 700975
*
Corynebacterium diphtheriae NCTC 13129

Site:
position = -2
score = 5.32765
sequence = TAATGAAAATAATTACCGATA

Gene: DIP2325: putative surface-anchored protein
 
Corynebacterium efficiens YS-314
 
Corynebacterium glutamicum ATCC 13032
 
Corynebacterium jeikeium K411
 
Corynebacterium kroppenstedtii DSM 44385
 
Corynebacterium urealyticum DSM 7109
putative surface-anchored protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD