Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog PirR - Cyanobacteria

Properties
Regulator type: Transcription factor
Regulator family: LysR
Regulation mode: repressor
Biological process: Salt stress response
Effector:
Phylum: Cyanobacteria
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Cyanothece sp. ATCC 51142 1 1
Cyanothece sp. PCC 7425
Cyanothece sp. PCC 8801
Gloeobacter violaceus PCC 7421
Microcystis aeruginosa NIES-843
Nostoc sp. PCC 7120
Prochlorococcus marinus str. MIT 9313
Synechococcus elongatus PCC 7942
Synechococcus sp. JA-3-3Ab
Synechococcus sp. PCC 7002 2 2
Synechococcus sp. WH 8102
Synechocystis sp. PCC 6803 2 2
Thermosynechococcus elongatus BP-1
Trichodesmium erythraeum IMS101
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
pirA
*
Cyanothece sp. ATCC 51142

Site:
position = -51
score = 5.05629
sequence = TTGTGTCTTTTTTAGATACTT

Site:
position = -22
score = 5.34322
sequence = TTGTCAATCATTTAGATACAA

Site:
position = 19
score = 5.29593
sequence = TTGTCTTTTATTTAAAAACAA

Gene: cce_2769: Pirin-like protein
 
Cyanothece sp. PCC 7425

Gene: Cyan7425_4378: Pirin-like protein
 
Cyanothece sp. PCC 8801

Gene: PCC8801_3564: Pirin-like protein
 
Gloeobacter violaceus PCC 7421

Gene: glr1823: Pirin-like protein
 
Microcystis aeruginosa NIES-843

Gene: MAE_12890: Pirin-like protein
 
Nostoc sp. PCC 7120

Gene: all1172: Pirin-like protein
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. PCC 7002

Site:
position = -115
score = 5.31593
sequence = TTGTTTCTTTTTGAGATACAT

Site:
position = -74
score = 5.08068
sequence = TTGTCTTTTATTTGGCGGCAA

Gene: SYNPCC7002_A2717: Pirin-like protein
 
Synechococcus sp. WH 8102
*
Synechocystis sp. PCC 6803

Site:
position = -118
score = 5.34187
sequence = TTGTCCCTATTTTGGATGCAA

Site:
position = -77
score = 5.03111
sequence = TTGTCTTTATTGGGGATGCAA

Gene: sll1773: Pirin-like protein
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101

Gene: Tery_0103: Pirin-like protein
Pirin-like protein
 
CRON 2.
pirR
 
Cyanothece sp. ATCC 51142

Gene: cce_3753: Salt stress response transcriptional regulator, LysR family
 
Cyanothece sp. PCC 7425
 
Cyanothece sp. PCC 8801
 
Gloeobacter violaceus PCC 7421
 
Microcystis aeruginosa NIES-843
 
Nostoc sp. PCC 7120
 
Prochlorococcus marinus str. MIT 9313
 
Synechococcus elongatus PCC 7942
 
Synechococcus sp. JA-3-3Ab
*
Synechococcus sp. PCC 7002

Site:
position = -143
score = 5.08068
sequence = TTGCCGCCAAATAAAAGACAA

Site:
position = -102
score = 5.31593
sequence = ATGTATCTCAAAAAGAAACAA

Gene: SYNPCC7002_A2718: Salt stress response transcriptional regulator, LysR family
 
Synechococcus sp. WH 8102
*
Synechocystis sp. PCC 6803

Site:
position = -73
score = 5.03111
sequence = TTGCATCCCCAATAAAGACAA

Site:
position = -32
score = 5.34187
sequence = TTGCATCCAAAATAGGGACAA

Gene: slr1871: Salt stress response transcriptional regulator, LysR family
 
Thermosynechococcus elongatus BP-1
 
Trichodesmium erythraeum IMS101
Salt stress response transcriptional regulator, LysR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD