Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TyrR - Pasteurellales

Properties
Regulator type: Transcription factor
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Actinobacillus pleuropneumoniae serovar 7 str. AP76 5 3
Actinobacillus succinogenes 130Z 3 2
Aggregatibacter aphrophilus NJ8700 2 2
Haemophilus ducreyi 35000HP 2 2
Haemophilus influenzae Rd KW20 2 2
Haemophilus parasuis SH0165 5 4
Haemophilus somnus 2336 2 2
Mannheimia succiniciproducens MBEL55E 4 3
Pasteurella multocida subsp. multocida str. Pm70 5 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tyrR
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -80
score = 6.08961
sequence = ATGTAAACAAAAGTTTCCAA

Gene: APP7_0857: Transcriptional regulator of aromatic amino acid biosynthesis
*
Actinobacillus succinogenes 130Z

Site:
position = -80
score = 4.76612
sequence = GTGTAAAGATAAGTTGACGT

Gene: Asuc_0958: Transcriptional regulator of aromatic amino acid biosynthesis
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -83
score = 5.80277
sequence = CTGTAAATAAAAGTTGCCAA

Gene: NT05HA_0604: Transcriptional regulator of aromatic amino acid biosynthesis
*
Haemophilus ducreyi 35000HP

Site:
position = -80
score = 6.17206
sequence = TTGTAAACAAAAGTTTCCAA

Gene: HD1229: Transcriptional regulator of aromatic amino acid biosynthesis
*
Haemophilus influenzae Rd KW20

Site:
position = -74
score = 5.57627
sequence = ATGTAAAATAATATTTACAC

Gene: HI0410: Transcriptional regulator of aromatic amino acid biosynthesis
*
Haemophilus parasuis SH0165

Site:
position = -84
score = 6.14147
sequence = TTGTAAACAAAAATTTCCAA

Gene: HAPS_1204: Transcriptional regulator of aromatic amino acid biosynthesis
 
Haemophilus somnus 2336

Gene: HSM_1076: Transcriptional regulator of aromatic amino acid biosynthesis
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -30
score = 5.77219
sequence = ATGTAAATAAAAGTTGCCAT

Gene: MS0762: Transcriptional regulator of aromatic amino acid biosynthesis
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -85
score = 5.31398
sequence = ATGTAAATTTATCTTTCCAG

Gene: PM0908: Transcriptional regulator of aromatic amino acid biosynthesis
Transcriptional regulator of aromatic amino acid biosynthesis
 
CRON 2.
aroF
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Site:
position = -34
score = 5.41387
sequence = CTGTATTTAAAATTTTACAG

Gene: APP7_0187: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Actinobacillus succinogenes 130Z

Site:
position = -41
score = 5.39517
sequence = TCGTACATAAAAATTTACAG

Gene: Asuc_1570: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Aggregatibacter aphrophilus NJ8700
*
Haemophilus ducreyi 35000HP

Site:
position = -32
score = 4.90415
sequence = ATGTATCAAAAATTTTACAC

Gene: HD0444: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Haemophilus influenzae Rd KW20
*
Haemophilus parasuis SH0165

Site:
position = -35
score = 4.78971
sequence = CTGTATTGATTTTTTTACAA

Gene: HAPS_1274: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Haemophilus somnus 2336
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -47
score = 5.80679
sequence = ATGTACATATAAATTTACAT

Gene: MS1104: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -86
score = 5.1255
sequence = ATGTAAATTATTTATTACAT

Site:
position = -63
score = 5.88659
sequence = GTGTATATAAATGTTTACAT

Gene: PM0665: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0186: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1569: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_0647: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Haemophilus ducreyi 35000HP
*
Haemophilus influenzae Rd KW20

Site:
position = -43
score = 5.76188
sequence = TTGTAATTAATTTTTTACAA

Site:
position = -20
score = 4.84618
sequence = ATGTAAGATAAAAATTACAG

Gene: HI1290: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Haemophilus parasuis SH0165

Gene: HAPS_1273: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
*
Haemophilus somnus 2336

Site:
position = -57
score = 4.97445
sequence = TTGTAAGTTATTTTTTACAA

Site:
position = -34
score = 5.71976
sequence = TTGTAATAATAAATGTACAA

Gene: HSM_1080: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Mannheimia succiniciproducens MBEL55E

Gene: MS1102: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
Pasteurella multocida subsp. multocida str. Pm70

Gene: PM0664: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
 
CRON 3.
tyrP
*2
Actinobacillus pleuropneumoniae serovar 7 str. AP76

Gene: APP7_0643: Tyrosine-specific transport protein

Site:
position = -97
score = 5.89377
sequence = GTGTAATAATATGTTTACAG

Gene: APP7_0642: Tyrosine-specific transport protein
 
Actinobacillus succinogenes 130Z

Gene: Asuc_1489: Tyrosine-specific transport protein
 
Aggregatibacter aphrophilus NJ8700

Gene: NT05HA_1757: Tyrosine-specific transport protein
 
Haemophilus ducreyi 35000HP

Gene: HD1499: Tyrosine-specific transport protein
 
Haemophilus influenzae Rd KW20

Gene: HI0528: Tyrosine-specific transport protein
*2
Haemophilus parasuis SH0165

Site:
position = -89
score = 5.59963
sequence = GTGTAATTATTTTTTTACAT

Gene: HAPS_0525: Tyrosine-specific transport protein

Site:
position = -174
score = 5.16335
sequence = TTGTAAAAGAAAGTTTACTA

Gene: HAPS_0526: Tyrosine-specific transport protein
*2
Haemophilus somnus 2336

Gene: HSM_1583: Tyrosine-specific transport protein

Site:
position = -99
score = 5.65725
sequence = ATGTAAACATAATATTACAT

Site:
position = -78
score = 5.73058
sequence = TTGTAAAAATAAAATTACAC

Gene: HSM_1247: Tyrosine-specific transport protein
*
Mannheimia succiniciproducens MBEL55E

Site:
position = -40
score = 5.53246
sequence = CCGTAAAAAAATAATTACAT

Gene: MS0977: Tyrosine-specific transport protein
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -101
score = 4.70836
sequence = CTGTAAAATAATAATAACAC

Site:
position = -82
score = 5.87135
sequence = CTGTAAAAAAATGGTTACAT

Gene: PM0732: Tyrosine-specific transport protein
Tyrosine-specific transport protein
 
CRON 4.
tpl
 
Actinobacillus pleuropneumoniae serovar 7 str. AP76
 
Actinobacillus succinogenes 130Z
*
Aggregatibacter aphrophilus NJ8700

Site:
position = -170
score = 4.53762
sequence = ATTTAAATTAAATTTAACAA

Gene: NT05HA_0124: Tyrosine phenol-lyase (EC 4.1.99.2)
 
Haemophilus ducreyi 35000HP
 
Haemophilus influenzae Rd KW20
 
Haemophilus parasuis SH0165
 
Haemophilus somnus 2336
 
Mannheimia succiniciproducens MBEL55E
*
Pasteurella multocida subsp. multocida str. Pm70

Site:
position = -134
score = 5.97816
sequence = GTGTAAATAATAATTTACAA

Gene: PM0811: Tyrosine phenol-lyase (EC 4.1.99.2)
Tyrosine phenol-lyase (EC 4.1.99.2)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD