Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TrpR - Vibrionales

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Tryptophan biosynthesis
Effector: Tryptophan
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Vibrio angustum S14 9 3
Vibrio cholerae O1 biovar eltor str. N16961 7 2
Vibrio fischeri ES114 8 2
Vibrio harveyi ATCC BAA-1116 7 2
Vibrio parahaemolyticus RIMD 2210633 8 3
Vibrio salmonicida LFI1238 7 2
Vibrio shilonii AK1 8 3
Vibrio splendidus LGP32 7 2
Vibrio vulnificus CMCP6 9 3
Photobacterium profundum SS9 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tnaA
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0161: Tryptophanase (EC 4.1.99.1)
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_05975: Tryptophanase (EC 4.1.99.1)
 
Vibrio splendidus LGP32
*
Vibrio vulnificus CMCP6

Site:
position = -192
score = 5.50843
sequence = CATACTAGTTTATTAGTACA

Gene: VV20854: Tryptophanase (EC 4.1.99.1)
 
Photobacterium profundum SS9
Tryptophanase (EC 4.1.99.1)
tnaB
*
Vibrio angustum S14

Site:
position = -40
score = 5.81686
sequence = TGTACTAGTTTACTGATACG

Gene: VAS14_21046: Tryptophan-specific transport protein
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VCA0160: Tryptophan-specific transport protein
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_05970: Tryptophan-specific transport protein
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6

Gene: VV20855: Tryptophan-specific transport protein
 
Photobacterium profundum SS9

Gene: PBPRA2533: Tryptophan-specific transport protein
Tryptophan-specific transport protein
 
CRON 2.
COG0733
 
Vibrio angustum S14
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -41
score = 6.11045
sequence = TGTACTAGTTAACTAGTGTG

Gene: VC2283: Predicted tryptophan transporter, SNF family
*
Vibrio fischeri ES114

Site:
position = -25
score = 5.41132
sequence = TGTACTAGTTGAGTGATACA

Gene: VF_0660: Predicted tryptophan transporter, SNF family
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -41
score = 6.00492
sequence = TGTACTAGTCAGCTAGTTCA

Gene: VIBHAR_03257: Predicted tryptophan transporter, SNF family
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -41
score = 6.32215
sequence = TGTACTAGTTAGCTAGTTCA

Gene: VP2337: Predicted tryptophan transporter, SNF family
*
Vibrio salmonicida LFI1238

Site:
position = -23
score = 4.81139
sequence = TGTACTAGTGTGGTGATACA

Gene: VSAL_I0762: Predicted tryptophan transporter, SNF family
*
Vibrio shilonii AK1

Site:
position = -22
score = 5.8895
sequence = TGTACCAGCAAACTAGTACG

Gene: VSAK1_12140: Predicted tryptophan transporter, SNF family
*
Vibrio splendidus LGP32

Site:
position = -41
score = 5.46353
sequence = TGTACTTCTCAACTAGTTCA

Gene: VS_0706: Predicted tryptophan transporter, SNF family
*
Vibrio vulnificus CMCP6

Site:
position = -38
score = 6.32215
sequence = TGTACTAGCTAACTAGTTCA

Gene: VV1_1834: Predicted tryptophan transporter, SNF family
 
Photobacterium profundum SS9
Predicted tryptophan transporter, SNF family
 
CRON 3.
aroA
*
Vibrio angustum S14

Site:
position = -73
score = 5.11241
sequence = GGTACTAGCTAACTGATGCA

Gene: VAS14_18534: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1732: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio fischeri ES114

Gene: VF_1761: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_01572: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1020: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I2218: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Vibrio shilonii AK1

Site:
position = -160
score = 5.08158
sequence = AGTACTAGCTGGCTAGTACT

Gene: VSAK1_04012: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio splendidus LGP32

Gene: VS_1079: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
Vibrio vulnificus CMCP6

Gene: VV1_2127: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
*
Photobacterium profundum SS9

Site:
position = -71
score = 4.68459
sequence = GGTACTAGCGAACTGATGCA

Gene: PBPRA2452: 5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
5-Enolpyruvylshikimate-3-phosphate synthase (EC 2.5.1.19)
 
CRON 4.
trpE
 
Vibrio angustum S14

Gene: VAS14_18369: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio cholerae O1 biovar eltor str. N16961

Site:
position = -294
score = 6.46042
sequence = CGCACTAGTTAACTAGTACG

Gene: VC1174: Anthranilate synthase, aminase component (EC 4.1.3.27)
*2
Vibrio fischeri ES114

Site:
position = -347
score = 6.30686
sequence = CGCACTAGTTTACTAGTACA

Gene: VF_2602: Anthranilate synthase, aminase component (EC 4.1.3.27)

Gene: VF_1033: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio harveyi ATCC BAA-1116

Site:
position = -351
score = 6.56868
sequence = TGCACTAGTTAACTAGTACA

Gene: VIBHAR_02758: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -352
score = 6.46042
sequence = CGCACTAGTTAACTAGTACG

Gene: VP1956: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio salmonicida LFI1238

Site:
position = -339
score = 6.25272
sequence = CGCACTAGTTTACTAGTACG

Gene: VSAL_I1154: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio shilonii AK1

Site:
position = -333
score = 6.49556
sequence = CGAACTAGTTAACTAGTACG

Gene: VSAK1_01022: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio splendidus LGP32

Site:
position = -317
score = 5.80691
sequence = AAAACTAGTTAACTAGTACA

Gene: VS_1966: Anthranilate synthase, aminase component (EC 4.1.3.27)
*
Vibrio vulnificus CMCP6

Site:
position = -355
score = 6.56868
sequence = TGCACTAGTTAACTAGTACA

Gene: VV1_3064: Anthranilate synthase, aminase component (EC 4.1.3.27)
 
Photobacterium profundum SS9

Gene: PBPRA2486: Anthranilate synthase, aminase component (EC 4.1.3.27)
Anthranilate synthase, aminase component (EC 4.1.3.27)
trpD_a
 
Vibrio angustum S14

Gene: VAS14_18364: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1173: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio fischeri ES114

Gene: VF_1032: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02759: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1957: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1153: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio shilonii AK1

Gene: VSAK1_01017: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio splendidus LGP32

Gene: VS_1967: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Vibrio vulnificus CMCP6

Gene: VV1_3065: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
 
Photobacterium profundum SS9

Gene: PBPRA2487: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
trpD_b
 
Vibrio angustum S14

Gene: VAS14_18359: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1172: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio fischeri ES114

Gene: VF_1031: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02760: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1958: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1152: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio shilonii AK1

Gene: VSAK1_01012: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio splendidus LGP32

Gene: VS_1968: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Vibrio vulnificus CMCP6

Gene: VV1_3066: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
 
Photobacterium profundum SS9

Gene: PBPRA2488: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
trpC
 
Vibrio angustum S14

Gene: VAS14_18354: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1171: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio fischeri ES114

Gene: VF_1029: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02761: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1959: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1151: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio shilonii AK1

Gene: VSAK1_01007: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio splendidus LGP32

Gene: VS_1969: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Vibrio vulnificus CMCP6

Gene: VV1_3067: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
 
Photobacterium profundum SS9

Gene: PBPRA2489: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24)
trpB
 
Vibrio angustum S14

Gene: VAS14_18349: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1170: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio fischeri ES114

Gene: VF_1028: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02762: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1960: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1150: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio shilonii AK1

Gene: VSAK1_01002: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio splendidus LGP32

Gene: VS_1970: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Vibrio vulnificus CMCP6

Gene: VV1_3068: Tryptophan synthase beta chain (EC 4.2.1.20)
 
Photobacterium profundum SS9

Gene: PBPRA2490: Tryptophan synthase beta chain (EC 4.2.1.20)
Tryptophan synthase beta chain (EC 4.2.1.20)
trpA
 
Vibrio angustum S14

Gene: VAS14_18344: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio cholerae O1 biovar eltor str. N16961

Gene: VC1169: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio fischeri ES114

Gene: VF_1027: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio harveyi ATCC BAA-1116

Gene: VIBHAR_02763: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio parahaemolyticus RIMD 2210633

Gene: VP1961: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio salmonicida LFI1238

Gene: VSAL_I1149: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio shilonii AK1

Gene: VSAK1_00997: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio splendidus LGP32

Gene: VS_1971: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Vibrio vulnificus CMCP6

Gene: VV1_3069: Tryptophan synthase alpha chain (EC 4.2.1.20)
 
Photobacterium profundum SS9

Gene: PBPRA2491: Tryptophan synthase alpha chain (EC 4.2.1.20)
Tryptophan synthase alpha chain (EC 4.2.1.20)
aroF2
*
Vibrio angustum S14

Site:
position = -322
score = 6.342
sequence = TGAACTAGTTTACTAGTACG

Gene: VAS14_18374: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
 
Vibrio parahaemolyticus RIMD 2210633
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
*
Photobacterium profundum SS9

Site:
position = -274
score = 6.28786
sequence = CGAACTAGTTTACTAGTACG

Gene: PBPRA2485: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
 
CRON 5.
trpB2
 
Vibrio angustum S14
 
Vibrio cholerae O1 biovar eltor str. N16961
 
Vibrio fischeri ES114
 
Vibrio harveyi ATCC BAA-1116
*
Vibrio parahaemolyticus RIMD 2210633

Site:
position = -116
score = 6.08899
sequence = CGTACTATTTAACTAGTTCA

Gene: VPA0585: Tryptophan synthase beta chain like (EC 4.2.1.20)
 
Vibrio salmonicida LFI1238
 
Vibrio shilonii AK1

Gene: VSAK1_17077: Tryptophan synthase beta chain like (EC 4.2.1.20)
 
Vibrio splendidus LGP32
 
Vibrio vulnificus CMCP6
 
Photobacterium profundum SS9
Tryptophan synthase beta chain like (EC 4.2.1.20)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD