Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR3 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F 3 2
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 2 2
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028
Desulfohalobium retbaense DSM 5692
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
arsM
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -43
score = 6.25008
sequence = CAAGGCAACATTAGTTGAATAG

Gene: Ddes_1926: Arsenite methyltransferase
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_37290: Arsenite methyltransferase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0953: Arsenite methyltransferase
Arsenite methyltransferase
 
CRON 2.
arsR3
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -29
score = 6.6336
sequence = CAGTTCAACATTCGTTGTATTA

Gene: DvMF_2392: putative transcriptional regulator, ArsR family
 
Desulfovibrio desulfuricans G20
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -29
score = 6.3244
sequence = CAATTCAATATAAGTTGAAATA

Gene: Ddes_1925: putative transcriptional regulator, ArsR family
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
putative transcriptional regulator, ArsR family
 
CRON 3.
arsD
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -65
score = 5.706
sequence = CAGTACAACAAGCATTGGCGTG

Gene: DvMF_2391: Arsenical resistance operon trans-acting repressor ArsD
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Arsenical resistance operon trans-acting repressor ArsD
arsA
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2390: arsenite-activated ATPase ArsA
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
arsenite-activated ATPase ArsA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD