Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR2 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20 4 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 4 1
Desulfovibrio magneticus RS-1 1 1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 1 1
Desulfohalobium retbaense DSM 5692
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
Dret_1782
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2778: redox-active disulfide protein 2
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -34
score = 5.41582
sequence = AATTTGCCAAATATAAACAT

Site:
position = -42
score = 5.66692
sequence = ATTTGGTTAATTTGCCAAAT

Gene: Desal_2205: redox-active disulfide protein 2
 
Desulfovibrio magneticus RS-1

Gene: DMR_37420: redox-active disulfide protein 2
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1782: redox-active disulfide protein 2
redox-active disulfide protein 2
trxA
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2781: Thioredoxin domain-containing protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2204: Thioredoxin domain-containing protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_37430: Thioredoxin domain-containing protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Thioredoxin domain-containing protein
Dbac_1909
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2782: thiol:disulfide interchange protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2203: thiol:disulfide interchange protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_37440: thiol:disulfide interchange protein
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0122: thiol:disulfide interchange protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1909: thiol:disulfide interchange protein
 
Desulfohalobium retbaense DSM 5692
thiol:disulfide interchange protein
arsR2
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2202: transcriptional regulator, ArsR family
 
Desulfovibrio magneticus RS-1

Gene: DMR_37370: transcriptional regulator, ArsR family
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -46
score = 5.58748
sequence = GTTTTGACATCTTGACATAT

Gene: Dbac_2827: transcriptional regulator, ArsR family
 
Desulfohalobium retbaense DSM 5692
transcriptional regulator, ArsR family
 
CRON 2.
Dde_2790
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
*
Desulfovibrio desulfuricans G20

Site:
position = -143
score = 5.58748
sequence = ATTTTGATGACACTCAAAAT

Gene: Dde_2790: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
hypothetical protein
arsB
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2791: Arsenical-resistance protein ACR3
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2201: Arsenical-resistance protein ACR3
 
Desulfovibrio magneticus RS-1

Gene: DMR_37380: Arsenical-resistance protein ACR3
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Arsenical-resistance protein ACR3
arsC-1
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2792: Arsenate reductase (EC 1.20.4.1)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -226
score = 5.02156
sequence = ATTTTGGTAGTTTGAAAAAT

Gene: DMR_01880: Arsenate reductase (EC 1.20.4.1)
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1452: Arsenate reductase (EC 1.20.4.1)
Arsenate reductase (EC 1.20.4.1)
arsC-2
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2793: Arsenate reductase
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Arsenate reductase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD