Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ArsR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenate
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 32 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 3 2
Desulfovibrio vulgaris str. Miyazaki F 1 1
Desulfovibrio desulfuricans G20 5 3
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098 2 2
Desulfovibrio salexigens DSM 2638 4 3
Desulfovibrio magneticus RS-1 7 3
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 4 2
Desulfohalobium retbaense DSM 5692 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
arsC
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -142
score = 5.00011
sequence = ACTTGATTATTTGGCAAAAT

Site:
position = -134
score = 5.98112
sequence = ATTTGGCAAAATAGACAAAT

Gene: DVU1646: Arsenate reductase (EC 1.20.4.1)
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2820: Arsenate reductase (EC 1.20.4.1)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -38
score = 4.56967
sequence = GTTTTCCTCTTTGGCAAAAT

Site:
position = -30
score = 5.25186
sequence = CTTTGGCAAAATATCCAAAC

Gene: Desal_2313: Arsenate reductase (EC 1.20.4.1)
 
Desulfovibrio magneticus RS-1

Gene: DMR_01870: Arsenate reductase (EC 1.20.4.1)
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1911: Arsenate reductase (EC 1.20.4.1)
 
Desulfohalobium retbaense DSM 5692
Arsenate reductase (EC 1.20.4.1)
 
CRON 2.
arsR
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -44
score = 5.98112
sequence = ATTTGTCTATTTTGCCAAAT

Site:
position = -36
score = 5.00011
sequence = ATTTTGCCAAATAATCAAGT

Gene: DVU1645: ArsR family transcriptional regulator
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -12
score = 5.01743
sequence = ATTTGGCGAAACATGCAAAT

Gene: DvMF_2281: ArsR family transcriptional regulator
*2
Desulfovibrio desulfuricans G20

Site:
position = -88
score = 5.73505
sequence = ATTTGGCTGAATCGCCAAAT

Site:
position = -39
score = 5.69525
sequence = ATTTGGCGAAAAAGCCAAAT

Gene: Dde_3721: ArsR family transcriptional regulator

Site:
position = -11
score = 5.14439
sequence = GCTTGGCCTAATTGCCAAAT

Gene: Dde_2776: ArsR family transcriptional regulator
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio piger ATCC 29098

Site:
position = -31
score = 5.6171
sequence = ATTTTGCCAAATGACCAAAT

Gene: DESPIG_02964: ArsR family transcriptional regulator
*
Desulfovibrio salexigens DSM 2638

Site:
position = -42
score = 5.35766
sequence = ATTTTTATATTTTGCCAAAC

Site:
position = -34
score = 4.77506
sequence = ATTTTGCCAAACAGGAAAGT

Gene: Desal_3295: ArsR family transcriptional regulator
*2
Desulfovibrio magneticus RS-1

Gene: DMR_20150: ArsR family transcriptional regulator

Site:
position = -39
score = 4.55387
sequence = ATTTTGCCAAATAGAAAACG

Site:
position = -47
score = 5.7459
sequence = TTTTGGCTATTTTGCCAAAT

Gene: DMR_37390: ArsR family transcriptional regulator
 
Lawsonia intracellularis PHE/MN1-00
*2
Desulfomicrobium baculatum DSM 4028

Site:
position = -160
score = 5.0289
sequence = ATTTGCACAAATGACCAAAT

Site:
position = -38
score = 5.13742
sequence = GCTTGGCAATATTGCCAAGT

Gene: Dbac_1906: ArsR family transcriptional regulator

Site:
position = -32
score = 5.0289
sequence = ATTTGGTCATTTGTGCAAAT

Site:
position = -154
score = 5.13742
sequence = ACTTGGCAATATTGCCAAGC

Gene: Dbac_1905: ArsR family transcriptional regulator
*
Desulfohalobium retbaense DSM 5692

Site:
position = -12
score = 4.18983
sequence = ACTTTGCCAAGTATGCAAAC

Site:
position = -20
score = 5.04426
sequence = ATTTGGTTACTTTGCCAAGT

Gene: Dret_1784: ArsR family transcriptional regulator
ArsR family transcriptional regulator
Dbac_1904
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1904: permease
 
Desulfohalobium retbaense DSM 5692
permease
Dbac_1903
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1903: redox-active disulfide protein 2
 
Desulfohalobium retbaense DSM 5692
redox-active disulfide protein 2
Desal_3293
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3293: hypothetical protein
*
Desulfovibrio magneticus RS-1

Site:
position = -76
score = 5.4227
sequence = ATTTGGCAAAACATACAAAT

Site:
position = -84
score = 5.66216
sequence = ATTTTGCTATTTGGCAAAAC

Gene: DMR_37400: hypothetical protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
hypothetical protein
Dret_1783
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1644: permease
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2282: permease
*2
Desulfovibrio desulfuricans G20

Gene: Dde_3722: permease

Site:
position = -31
score = 5.54095
sequence = ATTTGGCGAATCAGCCAAAC

Gene: Dde_2777: permease
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
*
Desulfovibrio piger ATCC 29098

Site:
position = -30
score = 5.1822
sequence = ATTTGGCAATTTTGCCAATA

Site:
position = -22
score = 4.48072
sequence = ATTTTGCCAATAAGGAATAT

Gene: DESPIG_02962: permease
*
Desulfovibrio salexigens DSM 2638

Site:
position = -39
score = 4.33632
sequence = AGTTTCGTATTTGGCAAAAT

Site:
position = -31
score = 4.85286
sequence = ATTTGGCAAAATATAAAGAC

Gene: Desal_3294: permease
*2
Desulfovibrio magneticus RS-1

Gene: DMR_37410: permease

Site:
position = -57
score = 5.27333
sequence = ATTTTGCCTTTTGACCAAAT

Site:
position = -49
score = 4.44721
sequence = TTTTGACCAAATAGCAAATC

Gene: DMR_20130: permease
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
*
Desulfohalobium retbaense DSM 5692

Site:
position = -49
score = 5.22424
sequence = ATTTGGCTTTTTGGGAAAAT

Site:
position = -42
score = 3.6874
sequence = TTTTTGGGAAAATAGAAAAT

Gene: Dret_1783: permease
permease
Dret_1782
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_2778: redox-active disulfide protein 2
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02961: redox-active disulfide protein 2
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2205: redox-active disulfide protein 2
 2
Desulfovibrio magneticus RS-1

Gene: DMR_37420: redox-active disulfide protein 2

Gene: DMR_20110: redox-active disulfide protein 2
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1782: redox-active disulfide protein 2
redox-active disulfide protein 2
DMR_20120
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_20120: Carboxymuconolactone decarboxylase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1781: Carboxymuconolactone decarboxylase
Carboxymuconolactone decarboxylase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD