Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog SahR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylhomocysteine
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 31 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 6 4
Desulfovibrio vulgaris str. Miyazaki F 5 3
Desulfovibrio desulfuricans G20 8 5
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 5 3
Desulfovibrio piger ATCC 29098 5 3
Desulfovibrio salexigens DSM 2638 5 3
Desulfovibrio magneticus RS-1 2 1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 3 1
Desulfohalobium retbaense DSM 5692 4 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
metT
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1978: Methionine transporter MetT
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3062: Methionine transporter MetT
*
Desulfovibrio desulfuricans G20

Site:
position = -131
score = 5.72692
sequence = TTATCAACTTAGTTTGATAT

Gene: Dde_2476: Methionine transporter MetT
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01866: Methionine transporter MetT
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2013: Methionine transporter MetT
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0985: Methionine transporter MetT
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Methionine transporter MetT
 
CRON 2.
metE
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -341
score = 5.33619
sequence = ATATCAGTATTTCCTGATGT

Gene: DVU3371: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2035: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
*
Desulfovibrio desulfuricans G20

Site:
position = -293
score = 4.43642
sequence = ATATTGATGAATCTTGATAT

Gene: Dde_2328: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -282
score = 4.80508
sequence = ATATAACAATATTTTTATAT

Site:
position = -274
score = 4.2127
sequence = ATATTTTTATATATTGAATT

Gene: Desal_0813: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metF
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -87
score = 6.39736
sequence = ATATCAATCTATCTTGATAT

Gene: DVU0997: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -208
score = 6.57713
sequence = ATATCAAGATAGCTTGATAT

Gene: DvMF_3034: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Desulfovibrio desulfuricans G20

Site:
position = -69
score = 4.48738
sequence = ATATTACAATAGGTCGATAT

Site:
position = -45
score = 6.20848
sequence = ATATAAGGCTATCTTGATAT

Gene: Dde_2525: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -80
score = 6.46068
sequence = ATATCAATTTATCTTGATAT

Gene: Ddes_2008: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
*
Desulfovibrio piger ATCC 29098

Site:
position = -73
score = 6.23645
sequence = TTATCAAGTTATATTGATAT

Gene: DESPIG_02490: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0814: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
 
CRON 3.
bhmT
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
*
Desulfohalobium retbaense DSM 5692

Site:
position = -102
score = 6.27377
sequence = ATATCAAAATATCTTGATAT

Gene: Dret_2255: Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
Betaine--homocysteine S-methyltransferase (EC 2.1.1.5)
 
CRON 4.
sahR
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -52
score = 5.91394
sequence = ACATCAAGTTTTCTTGATTT

Gene: DVU0606: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -103
score = 5.30723
sequence = AAATCAAGTTTTCTTGATGT

Gene: DvMF_2579: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio desulfuricans G20

Site:
position = 63
score = 5.34113
sequence = ACATCAACTTTTCTTGATTC

Gene: Dde_3135: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -57
score = 5.37803
sequence = ATATGCGGATAACTTGATAC

Site:
position = -35
score = 5.01252
sequence = GTATCAGCATAAATTGATTT

Gene: Ddes_0040: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio piger ATCC 29098

Site:
position = -83
score = 5.80101
sequence = ATATCCAGATAGGCTGATAT

Site:
position = -61
score = 4.05588
sequence = GCATCAAGCAAATTTGATAC

Gene: DESPIG_01931: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio salexigens DSM 2638

Site:
position = -39
score = 3.72898
sequence = ATATAAAGGTTTTGTTATGT

Gene: Desal_3078: Predicted regulator of methionine metabolism, ArsR family
*
Desulfovibrio magneticus RS-1

Site:
position = -18
score = 6.71464
sequence = ATATCAGGATATCTTGATAT

Gene: DMR_43430: Predicted regulator of methionine metabolism, ArsR family
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -45
score = 6.71464
sequence = ATATCAGGATATCTTGATAT

Gene: Dbac_2305: Predicted regulator of methionine metabolism, ArsR family
*
Desulfohalobium retbaense DSM 5692

Site:
position = -172
score = 4.7259
sequence = TTATCAACTTTTTCAGATAT

Gene: Dret_2302: Predicted regulator of methionine metabolism, ArsR family
Predicted regulator of methionine metabolism, ArsR family
ahcY
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0607: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2580: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio desulfuricans G20

Gene: Dde_3134: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0039: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01930: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3077: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfovibrio magneticus RS-1

Gene: DMR_43440: Adenosylhomocysteinase (EC 3.3.1.1)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0670: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2304: Adenosylhomocysteinase (EC 3.3.1.1)
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2301: Adenosylhomocysteinase (EC 3.3.1.1)
Adenosylhomocysteinase (EC 3.3.1.1)
metK
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2449: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2941: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfovibrio desulfuricans G20

Gene: Dde_1496: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2287: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01870: S-adenosylmethionine synthetase (EC 2.5.1.6)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -111
score = 4.792
sequence = ATATGCAAATTTATTTATAT

Gene: Desal_1278: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfovibrio magneticus RS-1

Gene: DMR_42050: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0726: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2303: S-adenosylmethionine synthetase (EC 2.5.1.6)
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2300: S-adenosylmethionine synthetase (EC 2.5.1.6)
S-adenosylmethionine synthetase (EC 2.5.1.6)
panC
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -18
score = 5.77158
sequence = ATATGTGGATAGGTTGATAT

Gene: DVU2448: Pantoate--beta-alanine ligase (EC 6.3.2.1)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -18
score = 5.4408
sequence = ATATTCGGATAACTTGATAT

Gene: DvMF_2942: Pantoate--beta-alanine ligase (EC 6.3.2.1)
*
Desulfovibrio desulfuricans G20

Site:
position = -18
score = 5.86775
sequence = ATATGCGGATACATTGATAT

Gene: Dde_1498: Pantoate--beta-alanine ligase (EC 6.3.2.1)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -18
score = 5.79116
sequence = ATATCACAATACCTTGATAT

Site:
position = -10
score = 4.24755
sequence = ATACCTTGATATGCAGATAT

Gene: Ddes_2286: Pantoate--beta-alanine ligase (EC 6.3.2.1)
*
Desulfovibrio piger ATCC 29098

Site:
position = -18
score = 6.09451
sequence = ATATCACCATACCTTGATAT

Site:
position = -10
score = 4.24755
sequence = ATACCTTGATATGCAGATAT

Gene: DESPIG_01871: Pantoate--beta-alanine ligase (EC 6.3.2.1)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1279: Pantoate--beta-alanine ligase (EC 6.3.2.1)
 
Desulfovibrio magneticus RS-1

Gene: DMR_42060: Pantoate--beta-alanine ligase (EC 6.3.2.1)
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1683: Pantoate--beta-alanine ligase (EC 6.3.2.1)
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1012: Pantoate--beta-alanine ligase (EC 6.3.2.1)
Pantoate--beta-alanine ligase (EC 6.3.2.1)
Dde_1497
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_1497: Uncharacterized conserved protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Uncharacterized conserved protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD