Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 43 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 13 5
Bacillus amyloliquefaciens FZB42 13 5
Bacillus pumilus SAFR-032 5 2
Bacillus licheniformis DSM 13 13 3
Anoxybacillus flavithermus WK1 6 2
Geobacillus kaustophilus HTA426 7 3
Bacillus cereus ATCC 14579
Bacillus halodurans C-125 12 5
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831 5 2
Paenibacillus sp. JDR-2 4 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
BH1061
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -172
score = 5.57692
sequence = TTATTCGTACGAACAAATAA

Gene: BH1061: Alpha-glucuronidase (EC 3.2.1.139)
 
Bacillus clausii KSM-K16

Gene: ABC0555: Alpha-glucuronidase (EC 3.2.1.139)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1323: Alpha-glucuronidase (EC 3.2.1.139)
Alpha-glucuronidase (EC 3.2.1.139)
 
CRON 2.
araA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -103
score = 5.853
sequence = AAAATTGTTCGTACAAATAT

Gene: BSU28800: L-arabinose isomerase (EC 5.3.1.4)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -57
score = 5.26869
sequence = ATATTCGTACGTATATTTTT

Site:
position = -99
score = 5.83127
sequence = AAAATTGTTCGTACAAATAA

Gene: RBAM_025860: L-arabinose isomerase (EC 5.3.1.4)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2327: L-arabinose isomerase (EC 5.3.1.4)
*2
Bacillus licheniformis DSM 13

Gene: BLi02064: L-arabinose isomerase (EC 5.3.1.4)

Site:
position = -125
score = 5.71286
sequence = TTAGTTGTACGTACATATAA

Site:
position = -155
score = 5.15606
sequence = GAAGTTGTTCGTACAAATAT

Gene: BLi03028: L-arabinose isomerase (EC 5.3.1.4)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0531: L-arabinose isomerase (EC 5.3.1.4)
 
Geobacillus kaustophilus HTA426

Gene: GK1904: L-arabinose isomerase (EC 5.3.1.4)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1873: L-arabinose isomerase (EC 5.3.1.4)
 
Bacillus clausii KSM-K16

Gene: ABC0408: L-arabinose isomerase (EC 5.3.1.4)
 
Oceanobacillus iheyensis HTE831

Gene: OB2797: L-arabinose isomerase (EC 5.3.1.4)
*
Paenibacillus sp. JDR-2

Site:
position = -83
score = 5.60097
sequence = TAAGTTGTACGTACAACTTA

Gene: Pjdr2_2502: L-arabinose isomerase (EC 5.3.1.4)
L-arabinose isomerase (EC 5.3.1.4)
araB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28790: Ribulokinase (EC 2.7.1.16)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025850: Ribulokinase (EC 2.7.1.16)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03027: Ribulokinase (EC 2.7.1.16)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0530: Ribulokinase (EC 2.7.1.16)
 
Geobacillus kaustophilus HTA426

Gene: GK1905: Ribulokinase (EC 2.7.1.16)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1872: Ribulokinase (EC 2.7.1.16)
 
Bacillus clausii KSM-K16

Gene: ABC0407: Ribulokinase (EC 2.7.1.16)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Ribulokinase (EC 2.7.1.16)
araD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28780: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025840: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2328: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 2
Bacillus licheniformis DSM 13

Gene: BLi02063: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)

Gene: BLi03026: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
*
Anoxybacillus flavithermus WK1

Site:
position = -54
score = 5.73456
sequence = AAAAATGTACGTACAAAATT

Gene: Aflv_0529: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
*
Geobacillus kaustophilus HTA426

Site:
position = -61
score = 5.63588
sequence = AAAATTGTACGTACAATAGT

Gene: GK1906: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -71
score = 5.71057
sequence = AAAATTGTACGTACAAGTGT

Gene: BH1871: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Bacillus clausii KSM-K16

Gene: ABC0406: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Oceanobacillus iheyensis HTE831

Gene: OB2798: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
*
Paenibacillus sp. JDR-2

Site:
position = -62
score = 5.30592
sequence = AAACATGTACGTACAAGTGT

Gene: Pjdr2_4207: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28770: L-arabinose utilization protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025830: L-arabinose utilization protein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0404: L-arabinose utilization protein
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
L-arabinose utilization protein
egsA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28760: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025820: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03025: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1862: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
 
Bacillus clausii KSM-K16

Gene: ABC0405: Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Glycerol-1-phosphate dehydrogenase [NAD(P)] (EC 1.1.1.261)
araN
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28750: Alpha-arabinosides ABC transport system, substrate-binding protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025810: Alpha-arabinosides ABC transport system, substrate-binding protein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03024: Alpha-arabinosides ABC transport system, substrate-binding protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0905: Alpha-arabinosides ABC transport system, substrate-binding protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-arabinosides ABC transport system, substrate-binding protein
araP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28740: Alpha-arabinosides ABC transport system, permease protein 1
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025800: Alpha-arabinosides ABC transport system, permease protein 1
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03023: Alpha-arabinosides ABC transport system, permease protein 1
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -49
score = 4.42753
sequence = AAACGTGTACGTACACGATA

Gene: BH0902: Alpha-arabinosides ABC transport system, permease protein 1
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-arabinosides ABC transport system, permease protein 1
araQ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28730: Alpha-arabinosides ABC transport system, permease protein 2
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025790: Alpha-arabinosides ABC transport system, permease protein 2
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03022: Alpha-arabinosides ABC transport system, permease protein 2
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0903: Alpha-arabinosides ABC transport system, permease protein 2
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-arabinosides ABC transport system, permease protein 2
abfA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU28720: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_025780: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi03021: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0533: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -198
score = 6.12355
sequence = AAATTTGTACGTACAAAAAA

Site:
position = -100
score = 5.51212
sequence = TATTATGTACGTACAAGTTA

Gene: BH1861: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
abf5
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0532: Alpha-L-arabinofuranosidase II precursor
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alpha-L-arabinofuranosidase II precursor
araK
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -102
score = 6.06043
sequence = ACATATGTACGTACAAATAT

Gene: BPUM_2329: Ribulokinase (EC 2.7.1.16)
*
Bacillus licheniformis DSM 13

Site:
position = -138
score = 5.03828
sequence = ATATTTATATGAACATATTA

Site:
position = -106
score = 5.78504
sequence = ACATATGTACGTACAAAAAA

Gene: BLi02062: Ribulokinase (EC 2.7.1.16)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
*
Oceanobacillus iheyensis HTE831

Site:
position = -152
score = 5.87614
sequence = TAATTTGTACGTATATATAT

Site:
position = -119
score = 5.38375
sequence = ACAAATGTACGTACAATAAT

Gene: OB2799: Ribulokinase (EC 2.7.1.16)
*
Paenibacillus sp. JDR-2

Site:
position = -100
score = 4.75903
sequence = TCACATGTACATACAAGTTA

Gene: Pjdr2_4209: Ribulokinase (EC 2.7.1.16)
Ribulokinase (EC 2.7.1.16)
araE
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -190
score = 5.26157
sequence = AAATGTATACGGACAAATTT

Site:
position = -109
score = 6.00642
sequence = ATATTTGTACGTACTAATTA

Site:
position = -66
score = 5.4564
sequence = ATATAAGTACGTACAATTGA

Gene: BSU33960: L-arabinose-proton symporter
*
Bacillus amyloliquefaciens FZB42

Site:
position = -152
score = 5.40942
sequence = TTATTTGTGCGTACTAATTT

Site:
position = -109
score = 5.58152
sequence = TCATAAGTACGTACAAATGT

Gene: RBAM_031320: L-arabinose-proton symporter
 
Bacillus pumilus SAFR-032

Gene: BPUM_2326: L-arabinose-proton symporter
 
Bacillus licheniformis DSM 13

Gene: BLi02065: L-arabinose-proton symporter
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB2796: L-arabinose-proton symporter
 
Paenibacillus sp. JDR-2
L-arabinose-proton symporter
xsa
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -173
score = 5.4802
sequence = AAATACATACGTACAAATAT

Gene: BSU28510: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -169
score = 5.56371
sequence = TAATTGGTTCGTACAAATTA

Gene: RBAM_025570: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2508: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1874: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
 
Bacillus clausii KSM-K16

Gene: ABC3371: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5206: Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
Alpha-N-arabinofuranosidase 2 (EC 3.2.1.55)
yteU
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0904: Predicted integral membrane protein
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Predicted integral membrane protein
araR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -48
score = 6.00642
sequence = TAATTAGTACGTACAAATAT

Site:
position = -91
score = 5.4564
sequence = TCAATTGTACGTACTTATAT

Gene: BSU33970: Transcriptional repressor of arabinoside utilization, GntR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -167
score = 5.58152
sequence = ACATTTGTACGTACTTATGA

Site:
position = -124
score = 5.40942
sequence = AAATTAGTACGCACAAATAA

Gene: RBAM_031330: Transcriptional repressor of arabinoside utilization, GntR family
*
Bacillus pumilus SAFR-032

Site:
position = -191
score = 6.06043
sequence = ATATTTGTACGTACATATGT

Gene: BPUM_2330: Transcriptional repressor of arabinoside utilization, GntR family
*2
Bacillus licheniformis DSM 13

Site:
position = -160
score = 5.03828
sequence = TAATATGTTCATATAAATAT

Site:
position = -192
score = 5.78504
sequence = TTTTTTGTACGTACATATGT

Gene: BLi02061: Transcriptional repressor of arabinoside utilization, GntR family

Gene: BLi03256: Transcriptional repressor of arabinoside utilization, GntR family
*
Anoxybacillus flavithermus WK1

Site:
position = -81
score = 5.87614
sequence = AAATATATACGTACAAATAA

Gene: Aflv_0528: Transcriptional repressor of arabinoside utilization, GntR family
*
Geobacillus kaustophilus HTA426

Site:
position = -75
score = 4.96238
sequence = ATAATGATACGGACAAATAA

Gene: GK1907: Transcriptional repressor of arabinoside utilization, GntR family
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -36
score = 5.22018
sequence = TCATTTGTACGTATAAGTTG

Gene: BH1875: Transcriptional repressor of arabinoside utilization, GntR family
 
Bacillus clausii KSM-K16
*
Oceanobacillus iheyensis HTE831

Site:
position = -203
score = 5.38375
sequence = ATTATTGTACGTACATTTGT

Site:
position = -170
score = 5.87614
sequence = ATATATATACGTACAAATTA

Site:
position = -63
score = 5.27937
sequence = AAATATGTACATACAAGTAT

Gene: OB2800: Transcriptional repressor of arabinoside utilization, GntR family
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4208: Transcriptional repressor of arabinoside utilization, GntR family
Transcriptional repressor of arabinoside utilization, GntR family
 
CRON 3.
araF
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00442: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = -36
score = 5.66463
sequence = TTAAATATACGTACAAATTT

Gene: GK1910: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3442: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
 
Bacillus clausii KSM-K16

Gene: ABC0409: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0661: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2)
araG
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00443: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1909: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3441: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
 
Bacillus clausii KSM-K16

Gene: ABC0410: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0662: L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
L-arabinose transport ATP-binding protein AraG (TC 3.A.1.2.2)
araH
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00444: L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1908: L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3440: L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
Bacillus clausii KSM-K16

Gene: ABC0411: L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0663: L-arabinose transport system permease protein (TC 3.A.1.2.2)
L-arabinose transport system permease protein (TC 3.A.1.2.2)
 
CRON 4.
abnA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -159
score = 5.18073
sequence = TTTTTTGTCTGTACAAATTA

Gene: BSU28810: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -105
score = 5.17601
sequence = TTTTTTGTCTGTACAAATAT

Gene: RBAM_025870: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
 
Bacillus pumilus SAFR-032
 2
Bacillus licheniformis DSM 13

Gene: BLi03029: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)

Gene: BLi01295: Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arabinan endo-1,5-alpha-L-arabinosidase (EC 3.2.1.99)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD