Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DctR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: OmpR
Regulation mode: repressor
Biological process: C4-dicarboxylate transport
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 1 1
Bacillus amyloliquefaciens FZB42 1 1
Bacillus pumilus SAFR-032 1 1
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426 1 1
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
dctA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -115
score = 4.2802
sequence = AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA

Gene: BSU04470: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
*
Bacillus amyloliquefaciens FZB42

Site:
position = -105
score = 4.2802
sequence = AGACCAAAAAGACCAAAATGTCCGTTATGATCATAA

Gene: RBAM_004800: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
*
Bacillus pumilus SAFR-032

Site:
position = -123
score = 4.2802
sequence = AGACCAAAAAGACCAAAATGTACGATATGTACATAA

Gene: BPUM_0419: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = 71
score = 4.2802
sequence = AGACCAAAAAGACCAAAACGACCATTATCACCATAA

Gene: GK0561: C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
C4-dicarboxylate transporter for succinate, fumurate, malate and oxaloacetate
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD