Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FruR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8
Thermotoga sp. RQ2 6 1
Thermotoga neapolitana DSM 4359
Thermotoga petrophila RKU-1
Thermotoga naphthophila RKU-10 6 1
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
fruR
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -62
score = 4.1948
sequence = ATCACAATATGTCATAATCAATCATAAAGCGATCACAA

Gene: TRQ2_0642: Predicted regulator of fructose utilization, DeoR family
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
*
Thermotoga naphthophila RKU-10

Site:
position = -61
score = 4.1948
sequence = ATCATAATACGTCATAATCAGTCATGAACCGATCACAA

Gene: Tnap_0927: Predicted regulator of fructose utilization, DeoR family
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted regulator of fructose utilization, DeoR family
fruK
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0641: 1-phosphofructokinase (EC 2.7.1.56)
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0928: 1-phosphofructokinase (EC 2.7.1.56)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
1-phosphofructokinase (EC 2.7.1.56)
fruB
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0640: PTS system, fructose-specific IIA component (EC 2.7.1.69)
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0929: PTS system, fructose-specific IIA component (EC 2.7.1.69)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
PTS system, fructose-specific IIA component (EC 2.7.1.69)
fruA
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0639: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0930: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
ptsH
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0638: Phosphotransferase system, phosphocarrier protein HPr
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0931: Phosphotransferase system, phosphocarrier protein HPr
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Phosphotransferase system, phosphocarrier protein HPr
ptsI
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0637: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0932: Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD