Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GudR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Glucarate utilization; Galactarate utilization
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 6 2
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 6 1
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16 7 3
Oceanobacillus iheyensis HTE831 7 1
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
gudR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -42
score = 5.47532
sequence = CTATTTTGTCTTACAATTGAA

Gene: BSU02500: Transcriptional regulator for glucarate/galactarate utilization, GntR family
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00288: Transcriptional regulator for glucarate/galactarate utilization, GntR family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -63
score = 5.94845
sequence = CCTATTTGTATTACAATTAAA

Gene: ABC0472: Transcriptional regulator for glucarate/galactarate utilization, GntR family
*
Oceanobacillus iheyensis HTE831

Site:
position = -90
score = 6.59235
sequence = TTTATTTGTCGGACAAATAAA

Gene: OB2842: Transcriptional regulator for glucarate/galactarate utilization, GntR family
 
Paenibacillus sp. JDR-2
Transcriptional regulator for glucarate/galactarate utilization, GntR family
kdgD
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -117
score = 7.00115
sequence = TTTATTTGTCTTACAATTAAA

Gene: BSU02460: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -119
score = 7.00115
sequence = TTTATTTGTCTTACAATTAAA

Gene: BLi00284: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -51
score = 6.4965
sequence = TTAATTTGTCTTACAATAAAA

Gene: ABC0471: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Oceanobacillus iheyensis HTE831

Gene: OB2841: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
 
Paenibacillus sp. JDR-2
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
kgsD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02470: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00285: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0470: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
 
Oceanobacillus iheyensis HTE831

Gene: OB2840: Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
 
Paenibacillus sp. JDR-2
Ketoglutarate semialdehyde dehydrogenase (EC 1.2.1.26)
tctB_Gud
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0469: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
 
Oceanobacillus iheyensis HTE831

Gene: OB2839: Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family small permease component, putative transporter for glucarate
tctA_Gud
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0468: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
 
Oceanobacillus iheyensis HTE831

Gene: OB2838: Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family large permease component, putative transporter for glucarate
tctC_Gud
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0467: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
 
Oceanobacillus iheyensis HTE831

Gene: OB2837: Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
 
Paenibacillus sp. JDR-2
Tripartite tricarboxylate transporter family receptor, putative transporter for glucarate
gudD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02490: Glucarate dehydratase (EC 4.2.1.40)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00287: Glucarate dehydratase (EC 4.2.1.40)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB2836: Glucarate dehydratase (EC 4.2.1.40)
 
Paenibacillus sp. JDR-2
Glucarate dehydratase (EC 4.2.1.40)
gudP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02480: Glucarate/galactarate transporter
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00286: Glucarate/galactarate transporter
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Glucarate/galactarate transporter
garD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02510: D-galactarate dehydratase (EC 4.2.1.42)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi00289: D-galactarate dehydratase (EC 4.2.1.42)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
D-galactarate dehydratase (EC 4.2.1.42)
 
CRON 2.
ABC0466
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -50
score = 5.94845
sequence = TCTATTTGTCTTACAATTAAT

Gene: ABC0466: Putative mannonate dehydratase (EC 4.2.1.8)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative mannonate dehydratase (EC 4.2.1.8)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD