Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BmrR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: MerR
Regulation mode: activator
Biological process: Multidrug resistance
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 2 1
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 1 1
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bmr
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -63
score = 4.65994
sequence = GACTCTCCCCTAGGAGGAGGTCT

Gene: BSU24010: Multidrug transporter (MFS family)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_010750: Multidrug transporter (MFS family)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0475: Multidrug transporter (MFS family)
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC0855: Multidrug transporter (MFS family)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1965: Multidrug transporter (MFS family)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5113: Multidrug transporter (MFS family)
Multidrug transporter (MFS family)
bmrR
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU24020: Transcriptional regulator of multidrug transporter, MerR family
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02784: Transcriptional regulator of multidrug transporter, MerR family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of multidrug transporter, MerR family
 
CRON 2.
BLi02783
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -257
score = 7.22663
sequence = GACCCTATAGTTGCTATAGGGTT

Gene: BLi02783: Flavoredoxin
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Flavoredoxin
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD