Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog FrlR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Fructoselysine utilization
Effector: Fructoselysine 6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 7 4
Bacillus amyloliquefaciens FZB42 7 4
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
frlR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = 1
score = 6.5247
sequence = TGTATTATAACGTCATAATACA

Gene: BSU32560: Transcriptional regulator of fructoselysine utilization, GntR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -61
score = 6.5247
sequence = TGTATTATAACGTCATAATACA

Gene: RBAM_029620: Transcriptional regulator of fructoselysine utilization, GntR family
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of fructoselysine utilization, GntR family
 
CRON 2.
frlO
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -54
score = 6.09537
sequence = TAGACTATAATGTTATATAACA

Site:
position = -44
score = 6.09537
sequence = TGTTATATAACATTATAGTCTA

Gene: BSU32600: Putative fructoselysine ABC transporter, substrate-binding component
*
Bacillus amyloliquefaciens FZB42

Site:
position = -32
score = 5.24276
sequence = CGGACTATAATGATATATAACG

Site:
position = -22
score = 5.77875
sequence = TGATATATAACGTTATAGTCCG

Gene: RBAM_029660: Putative fructoselysine ABC transporter, substrate-binding component
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative fructoselysine ABC transporter, substrate-binding component
frlN
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32590: Putative fructoselysine ABC transporter, permease 2 component
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029650: Putative fructoselysine ABC transporter, permease 2 component
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative fructoselysine ABC transporter, permease 2 component
frlM
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32580: Putative fructoselysine ABC transporter, permease component
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029640: Putative fructoselysine ABC transporter, permease component
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative fructoselysine ABC transporter, permease component
frlD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32570: Fructoselysine kinase
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029630: Fructoselysine kinase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Fructoselysine kinase
 
CRON 3.
frlB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -61
score = 5.28984
sequence = TTTAATATAACAATATATAATG

Site:
position = -41
score = 6.73554
sequence = TGTTATATAACGTTATATAATA

Gene: BSU32610: Fructoselysine-6-P-deglycase
*
Bacillus amyloliquefaciens FZB42

Site:
position = -43
score = 6.5923
sequence = TGTTATATAACATTATATAATA

Site:
position = -63
score = 5.45789
sequence = ATTAATATAACGTTATATAATG

Gene: RBAM_029670: Fructoselysine-6-P-deglycase
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Fructoselysine-6-P-deglycase
 
CRON 4.
yurJ
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -144
score = 6.5247
sequence = TGTATTATGACGTTATAATACA

Gene: BSU32550: Putative fructoselysine ABC transporter, ATP-binding protein
*
Bacillus amyloliquefaciens FZB42

Site:
position = -116
score = 6.5247
sequence = TGTATTATGACGTTATAATACA

Gene: RBAM_029610: Putative fructoselysine ABC transporter, ATP-binding protein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0152: Putative fructoselysine ABC transporter, ATP-binding protein
Putative fructoselysine ABC transporter, ATP-binding protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD